Incidental Mutation 'R6913:Dlgap2'
ID539173
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14778374 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 594 (M594K)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: M593K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: M593K

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: M593K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: M593K

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: M593K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: M593K

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: M594K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: M594K

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CGGCATCACGTGTGCTATTG -3'
(R):5'- TCAGAAGGCTGTTGCGCATG -3'

Sequencing Primer
(F):5'- GCTGTTCCAGATGAGTGAAGC -3'
(R):5'- AAGGCTGTTGCGCATGTCATTATG -3'
Posted On2018-11-06