Incidental Mutation 'R6913:Myom2'
ID 539174
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission 045034-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R6913 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 15107653-15183410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15115710 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 42 (S42A)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect probably benign
Transcript: ENSMUST00000033842
AA Change: S42A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: S42A

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,197,494 (GRCm39) I619N possibly damaging Het
Accsl T C 2: 93,696,488 (GRCm39) K41E possibly damaging Het
Actr6 T C 10: 89,562,558 (GRCm39) E107G probably damaging Het
Adam7 T A 14: 68,771,100 (GRCm39) M9L probably benign Het
Adamts12 T A 15: 11,215,778 (GRCm39) H266Q probably damaging Het
Adamts16 A G 13: 70,877,017 (GRCm39) F1208S possibly damaging Het
Ankrd11 T C 8: 123,621,650 (GRCm39) D734G probably benign Het
Ap1b1 T C 11: 4,962,972 (GRCm39) V43A possibly damaging Het
Asnsd1 A G 1: 53,387,390 (GRCm39) V79A probably damaging Het
Aste1 T A 9: 105,274,607 (GRCm39) S221R probably benign Het
Ccndbp1 G A 2: 120,840,347 (GRCm39) E94K probably benign Het
Cdc34 G A 10: 79,520,937 (GRCm39) probably null Het
Cdh16 T C 8: 105,348,896 (GRCm39) D67G probably benign Het
Chd8 T C 14: 52,451,951 (GRCm39) E1348G probably damaging Het
Chl1 C T 6: 103,642,909 (GRCm39) Q216* probably null Het
Cse1l G A 2: 166,771,797 (GRCm39) V353I possibly damaging Het
Ctbp2 G A 7: 132,616,455 (GRCm39) S160F possibly damaging Het
Cyp1a1 C A 9: 57,607,576 (GRCm39) T68K probably damaging Het
Dennd11 T C 6: 40,383,851 (GRCm39) N397S possibly damaging Het
Dlgap2 T A 8: 14,828,374 (GRCm39) M594K probably benign Het
Dnah6 C T 6: 73,189,505 (GRCm39) E48K probably benign Het
Dock2 A G 11: 34,647,049 (GRCm39) V35A probably damaging Het
Edem2 A T 2: 155,568,594 (GRCm39) S73R probably damaging Het
Eps15 T C 4: 109,218,427 (GRCm39) V430A probably benign Het
Frem2 T C 3: 53,424,242 (GRCm39) N3065S probably damaging Het
Gal3st4 A T 5: 138,269,090 (GRCm39) S123R possibly damaging Het
Garnl3 T A 2: 32,876,841 (GRCm39) I937F possibly damaging Het
Gfod2 C T 8: 106,443,995 (GRCm39) V183M possibly damaging Het
Glipr1l1 T C 10: 111,898,339 (GRCm39) probably null Het
Gm7145 T G 1: 117,913,711 (GRCm39) C198G probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
H2-Eb2 G A 17: 34,552,523 (GRCm39) A123T possibly damaging Het
Ighv1-55 T C 12: 115,172,129 (GRCm39) I7V probably benign Het
Itpripl2 G T 7: 118,090,332 (GRCm39) P76T possibly damaging Het
Kat6a C A 8: 23,393,215 (GRCm39) A231E possibly damaging Het
Lipo3 C T 19: 33,757,705 (GRCm39) V255I probably benign Het
Mamstr A T 7: 45,292,662 (GRCm39) M141L probably benign Het
Med13 A G 11: 86,210,702 (GRCm39) V480A probably benign Het
Mei1 A G 15: 81,973,810 (GRCm39) N523S probably benign Het
Mill2 A G 7: 18,590,351 (GRCm39) T144A probably null Het
Muc16 C A 9: 18,553,959 (GRCm39) L4111F unknown Het
Mylk2 G A 2: 152,755,610 (GRCm39) G258E possibly damaging Het
Nab1 C A 1: 52,503,995 (GRCm39) G401C possibly damaging Het
Nifk T C 1: 118,260,592 (GRCm39) V244A possibly damaging Het
Nipsnap2 C A 5: 129,830,357 (GRCm39) Q224K probably benign Het
Nop16 T G 13: 54,737,553 (GRCm39) K47Q probably damaging Het
Nup153 A T 13: 46,853,192 (GRCm39) S548R probably damaging Het
Or2at1 A C 7: 99,416,924 (GRCm39) D185A probably damaging Het
Or4g17 A G 2: 111,209,347 (GRCm39) M1V probably null Het
Or5b111 A G 19: 13,290,998 (GRCm39) I217T probably benign Het
Pard6g G A 18: 80,160,534 (GRCm39) V216I possibly damaging Het
Pcdh20 C T 14: 88,706,038 (GRCm39) V421I probably benign Het
Pcif1 G A 2: 164,726,224 (GRCm39) probably null Het
Pde11a C A 2: 76,168,084 (GRCm39) V290F probably damaging Het
Pisd T C 5: 32,894,773 (GRCm39) Y511C probably damaging Het
Polg A T 7: 79,110,405 (GRCm39) D276E probably damaging Het
Polr3b T C 10: 84,549,496 (GRCm39) V906A probably damaging Het
Prkcg C T 7: 3,362,335 (GRCm39) P270S probably benign Het
Rapgef2 T A 3: 78,993,281 (GRCm39) I884F probably damaging Het
Rpl13 C A 8: 123,830,014 (GRCm39) N113K possibly damaging Het
Rxra T A 2: 27,631,186 (GRCm39) I139N probably damaging Het
Sf3b5 T A 10: 12,884,487 (GRCm39) C41S probably benign Het
Spata31e3 G T 13: 50,399,293 (GRCm39) P1011H probably damaging Het
Stk24 C T 14: 121,540,221 (GRCm39) R126Q probably damaging Het
Taar8b T C 10: 23,967,963 (GRCm39) D77G possibly damaging Het
Tbc1d1 T A 5: 64,468,452 (GRCm39) C566S probably benign Het
Tenm3 A T 8: 48,751,972 (GRCm39) M948K probably damaging Het
Thbs4 T A 13: 92,894,444 (GRCm39) Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,172,126 (GRCm39) C61* probably null Het
Trp63 A G 16: 25,707,918 (GRCm39) E636G probably damaging Het
Try5 T C 6: 41,288,266 (GRCm39) Y121C probably damaging Het
Ttn G T 2: 76,660,755 (GRCm39) probably benign Het
Vamp1 T A 6: 125,195,908 (GRCm39) V55D probably damaging Het
Vmn2r117 T C 17: 23,698,537 (GRCm39) N12S probably damaging Het
Vmn2r90 G A 17: 17,924,323 (GRCm39) G41S probably damaging Het
Zfp462 T A 4: 55,007,775 (GRCm39) D71E probably benign Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15,119,490 (GRCm39) missense probably damaging 1.00
IGL00426:Myom2 APN 8 15,119,502 (GRCm39) missense probably benign 0.00
IGL00503:Myom2 APN 8 15,164,289 (GRCm39) splice site probably null
IGL01515:Myom2 APN 8 15,172,655 (GRCm39) missense probably benign 0.15
IGL01649:Myom2 APN 8 15,163,755 (GRCm39) missense probably benign 0.24
IGL01658:Myom2 APN 8 15,127,880 (GRCm39) missense probably damaging 1.00
IGL01786:Myom2 APN 8 15,156,330 (GRCm39) missense probably damaging 0.99
IGL01924:Myom2 APN 8 15,119,685 (GRCm39) missense probably benign 0.37
IGL01929:Myom2 APN 8 15,167,698 (GRCm39) missense probably damaging 0.96
IGL02016:Myom2 APN 8 15,175,195 (GRCm39) missense probably benign 0.01
IGL02511:Myom2 APN 8 15,115,743 (GRCm39) missense probably benign
IGL02558:Myom2 APN 8 15,164,237 (GRCm39) missense probably benign 0.31
IGL02944:Myom2 APN 8 15,154,065 (GRCm39) critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15,173,442 (GRCm39) splice site probably benign
IGL03195:Myom2 APN 8 15,161,844 (GRCm39) nonsense probably null
IGL03288:Myom2 APN 8 15,172,679 (GRCm39) missense probably damaging 0.99
IGL03402:Myom2 APN 8 15,115,731 (GRCm39) missense probably benign
yomama UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
yoyoma UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R0069:Myom2 UTSW 8 15,167,624 (GRCm39) missense probably benign
R0116:Myom2 UTSW 8 15,167,633 (GRCm39) missense probably damaging 1.00
R0131:Myom2 UTSW 8 15,133,329 (GRCm39) missense probably damaging 0.98
R0373:Myom2 UTSW 8 15,148,419 (GRCm39) missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15,154,123 (GRCm39) missense probably benign 0.09
R0544:Myom2 UTSW 8 15,119,796 (GRCm39) missense probably damaging 1.00
R0629:Myom2 UTSW 8 15,119,783 (GRCm39) missense probably damaging 0.98
R0634:Myom2 UTSW 8 15,169,216 (GRCm39) splice site probably benign
R0645:Myom2 UTSW 8 15,167,698 (GRCm39) missense probably damaging 0.96
R0730:Myom2 UTSW 8 15,149,326 (GRCm39) missense probably benign 0.00
R0744:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R0836:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R1033:Myom2 UTSW 8 15,158,934 (GRCm39) missense probably benign 0.04
R1103:Myom2 UTSW 8 15,160,827 (GRCm39) missense probably benign 0.22
R1110:Myom2 UTSW 8 15,172,413 (GRCm39) missense probably benign 0.44
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1353:Myom2 UTSW 8 15,156,424 (GRCm39) missense probably damaging 1.00
R1530:Myom2 UTSW 8 15,172,384 (GRCm39) missense probably damaging 1.00
R1544:Myom2 UTSW 8 15,154,059 (GRCm39) splice site probably benign
R1576:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably damaging 1.00
R1758:Myom2 UTSW 8 15,115,795 (GRCm39) missense probably benign 0.00
R1884:Myom2 UTSW 8 15,164,278 (GRCm39) missense probably benign 0.01
R1908:Myom2 UTSW 8 15,131,023 (GRCm39) missense probably damaging 1.00
R1962:Myom2 UTSW 8 15,182,599 (GRCm39) splice site probably null
R1977:Myom2 UTSW 8 15,135,263 (GRCm39) missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15,181,151 (GRCm39) missense probably damaging 1.00
R2049:Myom2 UTSW 8 15,156,379 (GRCm39) missense probably damaging 0.97
R2155:Myom2 UTSW 8 15,134,555 (GRCm39) missense probably damaging 0.98
R2314:Myom2 UTSW 8 15,113,927 (GRCm39) missense probably damaging 0.99
R2350:Myom2 UTSW 8 15,158,835 (GRCm39) missense probably benign 0.09
R2358:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15,148,348 (GRCm39) missense probably benign 0.00
R3418:Myom2 UTSW 8 15,135,294 (GRCm39) missense probably benign 0.01
R3606:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3607:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3735:Myom2 UTSW 8 15,119,676 (GRCm39) missense probably benign 0.01
R3756:Myom2 UTSW 8 15,152,650 (GRCm39) missense probably benign 0.11
R3902:Myom2 UTSW 8 15,154,165 (GRCm39) missense probably benign
R3951:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably benign 0.35
R4240:Myom2 UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
R4361:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15,156,459 (GRCm39) missense probably benign 0.02
R4736:Myom2 UTSW 8 15,131,271 (GRCm39) missense probably damaging 0.99
R5010:Myom2 UTSW 8 15,133,310 (GRCm39) missense probably damaging 0.98
R5108:Myom2 UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R5370:Myom2 UTSW 8 15,149,343 (GRCm39) missense probably benign 0.10
R5427:Myom2 UTSW 8 15,163,764 (GRCm39) missense probably benign 0.03
R5498:Myom2 UTSW 8 15,179,142 (GRCm39) missense probably benign 0.01
R5504:Myom2 UTSW 8 15,178,879 (GRCm39) missense probably damaging 1.00
R5567:Myom2 UTSW 8 15,152,546 (GRCm39) missense probably benign 0.01
R5743:Myom2 UTSW 8 15,130,914 (GRCm39) missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15,172,705 (GRCm39) missense probably benign 0.01
R5844:Myom2 UTSW 8 15,181,182 (GRCm39) critical splice donor site probably null
R5854:Myom2 UTSW 8 15,158,478 (GRCm39) missense probably benign
R6141:Myom2 UTSW 8 15,113,903 (GRCm39) missense probably damaging 1.00
R6209:Myom2 UTSW 8 15,154,173 (GRCm39) missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15,148,472 (GRCm39) splice site probably null
R6378:Myom2 UTSW 8 15,149,356 (GRCm39) missense probably benign 0.11
R6829:Myom2 UTSW 8 15,172,643 (GRCm39) nonsense probably null
R6957:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6958:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6960:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6961:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6962:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6999:Myom2 UTSW 8 15,134,531 (GRCm39) missense probably benign 0.22
R7148:Myom2 UTSW 8 15,134,577 (GRCm39) missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15,154,114 (GRCm39) missense probably damaging 1.00
R7298:Myom2 UTSW 8 15,148,411 (GRCm39) missense probably damaging 1.00
R7463:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably null 0.94
R7535:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7573:Myom2 UTSW 8 15,172,450 (GRCm39) missense probably damaging 1.00
R7590:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7690:Myom2 UTSW 8 15,161,717 (GRCm39) critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15,133,259 (GRCm39) missense probably damaging 1.00
R7822:Myom2 UTSW 8 15,158,454 (GRCm39) missense probably benign
R7948:Myom2 UTSW 8 15,135,306 (GRCm39) missense probably benign 0.00
R8094:Myom2 UTSW 8 15,119,418 (GRCm39) missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15,179,157 (GRCm39) missense probably damaging 1.00
R8292:Myom2 UTSW 8 15,182,888 (GRCm39) missense probably benign 0.01
R8514:Myom2 UTSW 8 15,175,153 (GRCm39) missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15,164,254 (GRCm39) missense probably benign 0.01
R8790:Myom2 UTSW 8 15,169,242 (GRCm39) missense probably damaging 1.00
R8824:Myom2 UTSW 8 15,164,169 (GRCm39) missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15,152,589 (GRCm39) nonsense probably null
R9024:Myom2 UTSW 8 15,113,936 (GRCm39) missense probably damaging 1.00
R9129:Myom2 UTSW 8 15,154,068 (GRCm39) missense probably damaging 1.00
R9224:Myom2 UTSW 8 15,178,804 (GRCm39) missense possibly damaging 0.89
R9237:Myom2 UTSW 8 15,152,591 (GRCm39) missense possibly damaging 0.85
R9321:Myom2 UTSW 8 15,172,464 (GRCm39) missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9343:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9375:Myom2 UTSW 8 15,149,210 (GRCm39) missense probably damaging 1.00
R9455:Myom2 UTSW 8 15,156,293 (GRCm39) missense probably benign 0.31
R9563:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
R9565:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
RF001:Myom2 UTSW 8 15,131,418 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTGTGCGTATATACAGGAATGC -3'
(R):5'- GGTTCTATGGACAGTGGCTGAC -3'

Sequencing Primer
(F):5'- CATGCCCAGGTGCATCTGTATG -3'
(R):5'- TGGCTGACAGGGGACAC -3'
Posted On 2018-11-06