Mutagenetix > Incidental Mutation

Incidental Mutation 'R6913:Myom2'

539174

Institutional Source

Beutler Lab

Gene Symbol

Myom2

Ensembl Gene

ENSMUSG00000031461

Gene Name

myomesin 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R6913 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15057653-15133541 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 15065710 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 42 (S42A)

Ref Sequence

ENSEMBL: ENSMUSP00000033842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033842]

AlphaFold

Q14BI5

Predicted Effect

probably benign
Transcript: ENSMUST00000033842
AA Change: S42A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: S42A

Domain	Start	End	E-Value	Type
low complexity region	34	63	N/A	INTRINSIC
low complexity region	79	87	N/A	INTRINSIC
coiled coil region	97	129	N/A	INTRINSIC
IG	160	247	7.7e-5	SMART
IG	284	373	8.01e-3	SMART
FN3	383	466	1.5e-14	SMART
FN3	511	594	1.79e-12	SMART
FN3	612	693	1.95e-13	SMART
FN3	711	794	8.69e-11	SMART
FN3	813	896	1.86e-10	SMART
IG_like	913	999	1.58e2	SMART
Blast:IG_like	1021	1106	1e-44	BLAST
IG_like	1135	1215	2.27e1	SMART
Blast:IG_like	1227	1321	9e-51	BLAST
IGc2	1357	1425	4.96e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,378,744	I619N	possibly damaging	Het
Accsl	T	C	2: 93,866,143	K41E	possibly damaging	Het
Actr6	T	C	10: 89,726,696	E107G	probably damaging	Het
Adam7	T	A	14: 68,533,651	M9L	probably benign	Het
Adamts12	T	A	15: 11,215,692	H266Q	probably damaging	Het
Adamts16	A	G	13: 70,728,898	F1208S	possibly damaging	Het
Ankrd11	T	C	8: 122,894,911	D734G	probably benign	Het
Ap1b1	T	C	11: 5,012,972	V43A	possibly damaging	Het
Asnsd1	A	G	1: 53,348,231	V79A	probably damaging	Het
Aste1	T	A	9: 105,397,408	S221R	probably benign	Het
Ccndbp1	G	A	2: 121,009,866	E94K	probably benign	Het
Cdc34	G	A	10: 79,685,103		probably null	Het
Cdh16	T	C	8: 104,622,264	D67G	probably benign	Het
Chd8	T	C	14: 52,214,494	E1348G	probably damaging	Het
Chl1	C	T	6: 103,665,948	Q216*	probably null	Het
Cse1l	G	A	2: 166,929,877	V353I	possibly damaging	Het
Ctbp2	G	A	7: 133,014,726	S160F	possibly damaging	Het
Cyp1a1	C	A	9: 57,700,293	T68K	probably damaging	Het
Dlgap2	T	A	8: 14,778,374	M594K	probably benign	Het
Dnah6	C	T	6: 73,212,522	E48K	probably benign	Het
Dock2	A	G	11: 34,756,222	V35A	probably damaging	Het
E330009J07Rik	T	C	6: 40,406,917	N397S	possibly damaging	Het
Edem2	A	T	2: 155,726,674	S73R	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Frem2	T	C	3: 53,516,821	N3065S	probably damaging	Het
Gal3st4	A	T	5: 138,270,828	S123R	possibly damaging	Het
Garnl3	T	A	2: 32,986,829	I937F	possibly damaging	Het
Gfod2	C	T	8: 105,717,363	V183M	possibly damaging	Het
Glipr1l1	T	C	10: 112,062,434		probably null	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm7145	T	G	1: 117,985,981	C198G	probably damaging	Het
Gm906	G	T	13: 50,245,257	P1011H	probably damaging	Het
H2-Eb2	G	A	17: 34,333,549	A123T	possibly damaging	Het
Ighv1-55	T	C	12: 115,208,509	I7V	probably benign	Het
Itpripl2	G	T	7: 118,491,109	P76T	possibly damaging	Het
Kat6a	C	A	8: 22,903,199	A231E	possibly damaging	Het
Lipo1	C	T	19: 33,780,305	V255I	probably benign	Het
Mamstr	A	T	7: 45,643,238	M141L	probably benign	Het
Med13	A	G	11: 86,319,876	V480A	probably benign	Het
Mei1	A	G	15: 82,089,609	N523S	probably benign	Het
Mill2	A	G	7: 18,856,426	T144A	probably null	Het
Muc16	C	A	9: 18,642,663	L4111F	unknown	Het
Mylk2	G	A	2: 152,913,690	G258E	possibly damaging	Het
Nab1	C	A	1: 52,464,836	G401C	possibly damaging	Het
Nifk	T	C	1: 118,332,862	V244A	possibly damaging	Het
Nipsnap2	C	A	5: 129,753,293	Q224K	probably benign	Het
Nop16	T	G	13: 54,589,740	K47Q	probably damaging	Het
Nup153	A	T	13: 46,699,716	S548R	probably damaging	Het
Olfr1284	A	G	2: 111,379,002	M1V	probably null	Het
Olfr1465	A	G	19: 13,313,634	I217T	probably benign	Het
Olfr521	A	C	7: 99,767,717	D185A	probably damaging	Het
Pard6g	G	A	18: 80,117,319	V216I	possibly damaging	Het
Pcdh20	C	T	14: 88,468,602	V421I	probably benign	Het
Pcif1	G	A	2: 164,884,304		probably null	Het
Pde11a	C	A	2: 76,337,740	V290F	probably damaging	Het
Pisd	T	C	5: 32,737,429	Y511C	probably damaging	Het
Polg	A	T	7: 79,460,657	D276E	probably damaging	Het
Polr3b	T	C	10: 84,713,632	V906A	probably damaging	Het
Prkcg	C	T	7: 3,313,819	P270S	probably benign	Het
Rapgef2	T	A	3: 79,085,974	I884F	probably damaging	Het
Rpl13	C	A	8: 123,103,275	N113K	possibly damaging	Het
Rxra	T	A	2: 27,741,174	I139N	probably damaging	Het
Sf3b5	T	A	10: 13,008,743	C41S	probably benign	Het
Stk24	C	T	14: 121,302,809	R126Q	probably damaging	Het
Taar8b	T	C	10: 24,092,065	D77G	possibly damaging	Het
Tbc1d1	T	A	5: 64,311,109	C566S	probably benign	Het
Tenm3	A	T	8: 48,298,937	M948K	probably damaging	Het
Thbs4	T	A	13: 92,757,936	Q693L	possibly damaging	Het
Tnfrsf26	A	T	7: 143,618,389	C61*	probably null	Het
Trp63	A	G	16: 25,889,168	E636G	probably damaging	Het
Try5	T	C	6: 41,311,332	Y121C	probably damaging	Het
Ttn	G	T	2: 76,830,411		probably benign	Het
Vamp1	T	A	6: 125,218,945	V55D	probably damaging	Het
Vmn2r117	T	C	17: 23,479,563	N12S	probably damaging	Het
Vmn2r90	G	A	17: 17,704,061	G41S	probably damaging	Het
Zfp462	T	A	4: 55,007,775	D71E	probably benign	Het

Other mutations in Myom2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom2	APN	8	15069490	missense	probably damaging	1.00
IGL00426:Myom2	APN	8	15069502	missense	probably benign	0.00
IGL00503:Myom2	APN	8	15114289	splice site	probably null
IGL01515:Myom2	APN	8	15122655	missense	probably benign	0.15
IGL01649:Myom2	APN	8	15113755	missense	probably benign	0.24
IGL01658:Myom2	APN	8	15077880	missense	probably damaging	1.00
IGL01786:Myom2	APN	8	15106330	missense	probably damaging	0.99
IGL01924:Myom2	APN	8	15069685	missense	probably benign	0.37
IGL01929:Myom2	APN	8	15117698	missense	probably damaging	0.96
IGL02016:Myom2	APN	8	15125195	missense	probably benign	0.01
IGL02511:Myom2	APN	8	15065743	missense	probably benign
IGL02558:Myom2	APN	8	15114237	missense	probably benign	0.31
IGL02944:Myom2	APN	8	15104065	critical splice acceptor site	probably null
IGL03052:Myom2	APN	8	15123442	splice site	probably benign
IGL03195:Myom2	APN	8	15111844	nonsense	probably null
IGL03288:Myom2	APN	8	15122679	missense	probably damaging	0.99
IGL03402:Myom2	APN	8	15065731	missense	probably benign
yomama	UTSW	8	15132895	missense	probably benign	0.10
yoyoma	UTSW	8	15132667	missense	probably damaging	0.99
R0069:Myom2	UTSW	8	15117624	missense	probably benign
R0116:Myom2	UTSW	8	15117633	missense	probably damaging	1.00
R0131:Myom2	UTSW	8	15083329	missense	probably damaging	0.98
R0373:Myom2	UTSW	8	15098419	missense	possibly damaging	0.91
R0463:Myom2	UTSW	8	15104123	missense	probably benign	0.09
R0544:Myom2	UTSW	8	15069796	missense	probably damaging	1.00
R0629:Myom2	UTSW	8	15069783	missense	probably damaging	0.98
R0634:Myom2	UTSW	8	15119216	splice site	probably benign
R0645:Myom2	UTSW	8	15117698	missense	probably damaging	0.96
R0730:Myom2	UTSW	8	15099326	missense	probably benign	0.00
R0744:Myom2	UTSW	8	15132924	nonsense	probably null
R0836:Myom2	UTSW	8	15132924	nonsense	probably null
R1033:Myom2	UTSW	8	15108934	missense	probably benign	0.04
R1103:Myom2	UTSW	8	15110827	missense	probably benign	0.22
R1110:Myom2	UTSW	8	15122413	missense	probably benign	0.44
R1208:Myom2	UTSW	8	15084631	missense	probably damaging	1.00
R1208:Myom2	UTSW	8	15084631	missense	probably damaging	1.00
R1353:Myom2	UTSW	8	15106424	missense	probably damaging	1.00
R1530:Myom2	UTSW	8	15122384	missense	probably damaging	1.00
R1544:Myom2	UTSW	8	15104059	splice site	probably benign
R1576:Myom2	UTSW	8	15084556	missense	probably damaging	1.00
R1758:Myom2	UTSW	8	15065795	missense	probably benign	0.00
R1884:Myom2	UTSW	8	15114278	missense	probably benign	0.01
R1908:Myom2	UTSW	8	15081023	missense	probably damaging	1.00
R1962:Myom2	UTSW	8	15132599	splice site	probably null
R1977:Myom2	UTSW	8	15085263	missense	possibly damaging	0.47
R2018:Myom2	UTSW	8	15131151	missense	probably damaging	1.00
R2049:Myom2	UTSW	8	15106379	missense	probably damaging	0.97
R2155:Myom2	UTSW	8	15084555	missense	probably damaging	0.98
R2314:Myom2	UTSW	8	15063927	missense	probably damaging	0.99
R2350:Myom2	UTSW	8	15108835	missense	probably benign	0.09
R2358:Myom2	UTSW	8	15112018	missense	possibly damaging	0.68
R2904:Myom2	UTSW	8	15098348	missense	probably benign	0.00
R3418:Myom2	UTSW	8	15085294	missense	probably benign	0.01
R3606:Myom2	UTSW	8	15069775	missense	probably damaging	1.00
R3607:Myom2	UTSW	8	15069775	missense	probably damaging	1.00
R3735:Myom2	UTSW	8	15069676	missense	probably benign	0.01
R3756:Myom2	UTSW	8	15102650	missense	probably benign	0.11
R3902:Myom2	UTSW	8	15104165	missense	probably benign
R3951:Myom2	UTSW	8	15084556	missense	probably benign	0.35
R4240:Myom2	UTSW	8	15132895	missense	probably benign	0.10
R4361:Myom2	UTSW	8	15112018	missense	possibly damaging	0.68
R4581:Myom2	UTSW	8	15106459	missense	probably benign	0.02
R4736:Myom2	UTSW	8	15081271	missense	probably damaging	0.99
R5010:Myom2	UTSW	8	15083310	missense	probably damaging	0.98
R5108:Myom2	UTSW	8	15132667	missense	probably damaging	0.99
R5370:Myom2	UTSW	8	15099343	missense	probably benign	0.10
R5427:Myom2	UTSW	8	15113764	missense	probably benign	0.03
R5498:Myom2	UTSW	8	15129142	missense	probably benign	0.01
R5504:Myom2	UTSW	8	15128879	missense	probably damaging	1.00
R5567:Myom2	UTSW	8	15102546	missense	probably benign	0.01
R5743:Myom2	UTSW	8	15080914	missense	possibly damaging	0.82
R5745:Myom2	UTSW	8	15122705	missense	probably benign	0.01
R5844:Myom2	UTSW	8	15131182	critical splice donor site	probably null
R5854:Myom2	UTSW	8	15108478	missense	probably benign
R6141:Myom2	UTSW	8	15063903	missense	probably damaging	1.00
R6209:Myom2	UTSW	8	15104173	missense	possibly damaging	0.76
R6248:Myom2	UTSW	8	15098472	splice site	probably null
R6378:Myom2	UTSW	8	15099356	missense	probably benign	0.11
R6829:Myom2	UTSW	8	15122643	nonsense	probably null
R6957:Myom2	UTSW	8	15117741	missense	probably null	0.42
R6958:Myom2	UTSW	8	15117741	missense	probably null	0.42
R6960:Myom2	UTSW	8	15117741	missense	probably null	0.42
R6961:Myom2	UTSW	8	15117741	missense	probably null	0.42
R6962:Myom2	UTSW	8	15117741	missense	probably null	0.42
R6999:Myom2	UTSW	8	15084531	missense	probably benign	0.22
R7148:Myom2	UTSW	8	15084577	missense	possibly damaging	0.72
R7210:Myom2	UTSW	8	15104114	missense	probably damaging	1.00
R7298:Myom2	UTSW	8	15098411	missense	probably damaging	1.00
R7463:Myom2	UTSW	8	15117679	missense	probably null	0.94
R7535:Myom2	UTSW	8	15117679	missense	probably damaging	1.00
R7573:Myom2	UTSW	8	15122450	missense	probably damaging	1.00
R7590:Myom2	UTSW	8	15117679	missense	probably damaging	1.00
R7690:Myom2	UTSW	8	15111717	critical splice acceptor site	probably null
R7794:Myom2	UTSW	8	15083259	missense	probably damaging	1.00
R7822:Myom2	UTSW	8	15108454	missense	probably benign
R7948:Myom2	UTSW	8	15085306	missense	probably benign	0.00
R8094:Myom2	UTSW	8	15069418	missense	possibly damaging	0.94
R8268:Myom2	UTSW	8	15129157	missense	probably damaging	1.00
R8292:Myom2	UTSW	8	15132888	missense	probably benign	0.01
R8514:Myom2	UTSW	8	15125153	missense	possibly damaging	0.65
R8539:Myom2	UTSW	8	15114254	missense	probably benign	0.01
R8790:Myom2	UTSW	8	15119242	missense	probably damaging	1.00
R8824:Myom2	UTSW	8	15114169	missense	possibly damaging	0.82
R8895:Myom2	UTSW	8	15102589	nonsense	probably null
R9024:Myom2	UTSW	8	15063936	missense	probably damaging	1.00
R9129:Myom2	UTSW	8	15104068	missense	probably damaging	1.00
R9224:Myom2	UTSW	8	15128804	missense	possibly damaging	0.89
R9237:Myom2	UTSW	8	15102591	missense	possibly damaging	0.85
R9321:Myom2	UTSW	8	15122464	missense	possibly damaging	0.91
R9341:Myom2	UTSW	8	15084633	missense	probably damaging	0.97
R9343:Myom2	UTSW	8	15084633	missense	probably damaging	0.97
R9375:Myom2	UTSW	8	15099210	missense	probably damaging	1.00
R9455:Myom2	UTSW	8	15106293	missense	probably benign	0.31
R9563:Myom2	UTSW	8	15108399	nonsense	probably null
R9565:Myom2	UTSW	8	15108399	nonsense	probably null
RF001:Myom2	UTSW	8	15081418	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- TGTGTGCGTATATACAGGAATGC -3'
(R):5'- GGTTCTATGGACAGTGGCTGAC -3'

Sequencing Primer
(F):5'- CATGCCCAGGTGCATCTGTATG -3'
(R):5'- TGGCTGACAGGGGACAC -3'

Posted On

2018-11-06