Incidental Mutation 'R6913:Kat6a'
ID539175
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22903199 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 231 (A231E)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044331
AA Change: A231E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: A231E

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110696
AA Change: A231E

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: A231E

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6223:Kat6a UTSW 8 22940426 missense unknown
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
R7618:Kat6a UTSW 8 22862562 missense possibly damaging 0.95
R7768:Kat6a UTSW 8 22903212 missense probably damaging 1.00
R8051:Kat6a UTSW 8 22910249 missense probably damaging 0.99
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Z1176:Kat6a UTSW 8 22910154 missense probably damaging 1.00
Z1177:Kat6a UTSW 8 22940166 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGGGCAAAAGCAAGTTTTATGGG -3'
(R):5'- CTGCTGTGACTTAAACATGTGATC -3'

Sequencing Primer
(F):5'- CAAAAGCAAGTTTTATGGGAACTTAC -3'
(R):5'- CATAAGACATTTACAAAACACACCTG -3'
Posted On2018-11-06