Incidental Mutation 'R6913:Med13'
ID539192
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86319876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 480 (V480A)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: V480A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: V480A

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R8062:Med13 UTSW 11 86319438 missense probably benign
R8075:Med13 UTSW 11 86272470 missense probably damaging 0.98
R8207:Med13 UTSW 11 86303549 missense probably damaging 1.00
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTGTTTTAGTCACTCCTTCATC -3'
(R):5'- CCAATGACCTTACTGTCTCAAAATC -3'

Sequencing Primer
(F):5'- TAGTCACTCCTTCATCAACCACATC -3'
(R):5'- CCATCTTTAGGGCAGCAA -3'
Posted On2018-11-06