Incidental Mutation 'R6913:Nop16'
ID539196
Institutional Source Beutler Lab
Gene Symbol Nop16
Ensembl Gene ENSMUSG00000025869
Gene NameNOP16 nucleolar protein
SynonymsD13Wsu177e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.883) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54584185-54590090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54589740 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 47 (K47Q)
Ref Sequence ENSEMBL: ENSMUSP00000122180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026986] [ENSMUST00000026987] [ENSMUST00000049575] [ENSMUST00000091609] [ENSMUST00000140142] [ENSMUST00000148222] [ENSMUST00000149462]
Predicted Effect probably benign
Transcript: ENSMUST00000026986
SMART Domains Protein: ENSMUSP00000026986
Gene: ENSMUSG00000025868

DomainStartEndE-ValueType
Pfam:HIG_1_N 45 96 5.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000026987
AA Change: K47Q

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026987
Gene: ENSMUSG00000025869
AA Change: K47Q

DomainStartEndE-ValueType
Pfam:Nop16 4 157 7.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049575
SMART Domains Protein: ENSMUSP00000053371
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 228 2.9e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091609
SMART Domains Protein: ENSMUSP00000089198
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 210 8.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140142
SMART Domains Protein: ENSMUSP00000122336
Gene: ENSMUSG00000047547

DomainStartEndE-ValueType
Pfam:Clathrin_lg_ch 1 95 2.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148222
AA Change: K47Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122180
Gene: ENSMUSG00000025869
AA Change: K47Q

DomainStartEndE-ValueType
Pfam:Nop16 5 88 9.9e-11 PFAM
Pfam:Nop16 67 156 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149462
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the nucleolus. Expression of this gene is induced by estrogens and Myc protein and is a marker of poor patient survival in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Nop16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2300:Nop16 UTSW 13 54585866 unclassified probably null
R7491:Nop16 UTSW 13 54588604 missense probably benign 0.01
R7515:Nop16 UTSW 13 54589737 missense possibly damaging 0.74
R7810:Nop16 UTSW 13 54590076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTTTGACCAGAATTAGTGCAAGC -3'
(R):5'- AAGCGTCTGAACCGGAATGC -3'

Sequencing Primer
(F):5'- GAGAACAAATTCTGAAACTCTGCTC -3'
(R):5'- TCTGAACCGGAATGCTCGTC -3'
Posted On2018-11-06