Incidental Mutation 'R6913:Adamts16'
ID 539197
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 045034-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6913 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70877017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1208 (F1208S)
Ref Sequence ENSEMBL: ENSMUSP00000079041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect possibly damaging
Transcript: ENSMUST00000080145
AA Change: F1208S

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: F1208S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123552
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,197,494 (GRCm39) I619N possibly damaging Het
Accsl T C 2: 93,696,488 (GRCm39) K41E possibly damaging Het
Actr6 T C 10: 89,562,558 (GRCm39) E107G probably damaging Het
Adam7 T A 14: 68,771,100 (GRCm39) M9L probably benign Het
Adamts12 T A 15: 11,215,778 (GRCm39) H266Q probably damaging Het
Ankrd11 T C 8: 123,621,650 (GRCm39) D734G probably benign Het
Ap1b1 T C 11: 4,962,972 (GRCm39) V43A possibly damaging Het
Asnsd1 A G 1: 53,387,390 (GRCm39) V79A probably damaging Het
Aste1 T A 9: 105,274,607 (GRCm39) S221R probably benign Het
Ccndbp1 G A 2: 120,840,347 (GRCm39) E94K probably benign Het
Cdc34 G A 10: 79,520,937 (GRCm39) probably null Het
Cdh16 T C 8: 105,348,896 (GRCm39) D67G probably benign Het
Chd8 T C 14: 52,451,951 (GRCm39) E1348G probably damaging Het
Chl1 C T 6: 103,642,909 (GRCm39) Q216* probably null Het
Cse1l G A 2: 166,771,797 (GRCm39) V353I possibly damaging Het
Ctbp2 G A 7: 132,616,455 (GRCm39) S160F possibly damaging Het
Cyp1a1 C A 9: 57,607,576 (GRCm39) T68K probably damaging Het
Dennd11 T C 6: 40,383,851 (GRCm39) N397S possibly damaging Het
Dlgap2 T A 8: 14,828,374 (GRCm39) M594K probably benign Het
Dnah6 C T 6: 73,189,505 (GRCm39) E48K probably benign Het
Dock2 A G 11: 34,647,049 (GRCm39) V35A probably damaging Het
Edem2 A T 2: 155,568,594 (GRCm39) S73R probably damaging Het
Eps15 T C 4: 109,218,427 (GRCm39) V430A probably benign Het
Frem2 T C 3: 53,424,242 (GRCm39) N3065S probably damaging Het
Gal3st4 A T 5: 138,269,090 (GRCm39) S123R possibly damaging Het
Garnl3 T A 2: 32,876,841 (GRCm39) I937F possibly damaging Het
Gfod2 C T 8: 106,443,995 (GRCm39) V183M possibly damaging Het
Glipr1l1 T C 10: 111,898,339 (GRCm39) probably null Het
Gm7145 T G 1: 117,913,711 (GRCm39) C198G probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
H2-Eb2 G A 17: 34,552,523 (GRCm39) A123T possibly damaging Het
Ighv1-55 T C 12: 115,172,129 (GRCm39) I7V probably benign Het
Itpripl2 G T 7: 118,090,332 (GRCm39) P76T possibly damaging Het
Kat6a C A 8: 23,393,215 (GRCm39) A231E possibly damaging Het
Lipo3 C T 19: 33,757,705 (GRCm39) V255I probably benign Het
Mamstr A T 7: 45,292,662 (GRCm39) M141L probably benign Het
Med13 A G 11: 86,210,702 (GRCm39) V480A probably benign Het
Mei1 A G 15: 81,973,810 (GRCm39) N523S probably benign Het
Mill2 A G 7: 18,590,351 (GRCm39) T144A probably null Het
Muc16 C A 9: 18,553,959 (GRCm39) L4111F unknown Het
Mylk2 G A 2: 152,755,610 (GRCm39) G258E possibly damaging Het
Myom2 T G 8: 15,115,710 (GRCm39) S42A probably benign Het
Nab1 C A 1: 52,503,995 (GRCm39) G401C possibly damaging Het
Nifk T C 1: 118,260,592 (GRCm39) V244A possibly damaging Het
Nipsnap2 C A 5: 129,830,357 (GRCm39) Q224K probably benign Het
Nop16 T G 13: 54,737,553 (GRCm39) K47Q probably damaging Het
Nup153 A T 13: 46,853,192 (GRCm39) S548R probably damaging Het
Or2at1 A C 7: 99,416,924 (GRCm39) D185A probably damaging Het
Or4g17 A G 2: 111,209,347 (GRCm39) M1V probably null Het
Or5b111 A G 19: 13,290,998 (GRCm39) I217T probably benign Het
Pard6g G A 18: 80,160,534 (GRCm39) V216I possibly damaging Het
Pcdh20 C T 14: 88,706,038 (GRCm39) V421I probably benign Het
Pcif1 G A 2: 164,726,224 (GRCm39) probably null Het
Pde11a C A 2: 76,168,084 (GRCm39) V290F probably damaging Het
Pisd T C 5: 32,894,773 (GRCm39) Y511C probably damaging Het
Polg A T 7: 79,110,405 (GRCm39) D276E probably damaging Het
Polr3b T C 10: 84,549,496 (GRCm39) V906A probably damaging Het
Prkcg C T 7: 3,362,335 (GRCm39) P270S probably benign Het
Rapgef2 T A 3: 78,993,281 (GRCm39) I884F probably damaging Het
Rpl13 C A 8: 123,830,014 (GRCm39) N113K possibly damaging Het
Rxra T A 2: 27,631,186 (GRCm39) I139N probably damaging Het
Sf3b5 T A 10: 12,884,487 (GRCm39) C41S probably benign Het
Spata31e3 G T 13: 50,399,293 (GRCm39) P1011H probably damaging Het
Stk24 C T 14: 121,540,221 (GRCm39) R126Q probably damaging Het
Taar8b T C 10: 23,967,963 (GRCm39) D77G possibly damaging Het
Tbc1d1 T A 5: 64,468,452 (GRCm39) C566S probably benign Het
Tenm3 A T 8: 48,751,972 (GRCm39) M948K probably damaging Het
Thbs4 T A 13: 92,894,444 (GRCm39) Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,172,126 (GRCm39) C61* probably null Het
Trp63 A G 16: 25,707,918 (GRCm39) E636G probably damaging Het
Try5 T C 6: 41,288,266 (GRCm39) Y121C probably damaging Het
Ttn G T 2: 76,660,755 (GRCm39) probably benign Het
Vamp1 T A 6: 125,195,908 (GRCm39) V55D probably damaging Het
Vmn2r117 T C 17: 23,698,537 (GRCm39) N12S probably damaging Het
Vmn2r90 G A 17: 17,924,323 (GRCm39) G41S probably damaging Het
Zfp462 T A 4: 55,007,775 (GRCm39) D71E probably benign Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3842:Adamts16 UTSW 13 70,887,010 (GRCm39) missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5735:Adamts16 UTSW 13 70,984,337 (GRCm39) missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8231:Adamts16 UTSW 13 70,925,599 (GRCm39) missense probably damaging 0.99
R8232:Adamts16 UTSW 13 70,941,217 (GRCm39) missense probably damaging 1.00
R8470:Adamts16 UTSW 13 70,984,496 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATCCACTCTAGGTCAAAAGAC -3'
(R):5'- TGCAAGGCCCCTTTAACAGC -3'

Sequencing Primer
(F):5'- TCTAGGTCAAAAGACCCACAGTC -3'
(R):5'- AGCCTCAAGACCCACATTTTCTAGTG -3'
Posted On 2018-11-06