Mutagenetix > Incidental Mutation

Incidental Mutation 'R6913:Adamts12'

539203

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6913 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11215692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 266 (H266Q)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061318
AA Change: H266Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: H266Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,378,744	I619N	possibly damaging	Het
Accsl	T	C	2: 93,866,143	K41E	possibly damaging	Het
Actr6	T	C	10: 89,726,696	E107G	probably damaging	Het
Adam7	T	A	14: 68,533,651	M9L	probably benign	Het
Adamts16	A	G	13: 70,728,898	F1208S	possibly damaging	Het
Ankrd11	T	C	8: 122,894,911	D734G	probably benign	Het
Ap1b1	T	C	11: 5,012,972	V43A	possibly damaging	Het
Asnsd1	A	G	1: 53,348,231	V79A	probably damaging	Het
Aste1	T	A	9: 105,397,408	S221R	probably benign	Het
Ccndbp1	G	A	2: 121,009,866	E94K	probably benign	Het
Cdc34	G	A	10: 79,685,103		probably null	Het
Cdh16	T	C	8: 104,622,264	D67G	probably benign	Het
Chd8	T	C	14: 52,214,494	E1348G	probably damaging	Het
Chl1	C	T	6: 103,665,948	Q216*	probably null	Het
Cse1l	G	A	2: 166,929,877	V353I	possibly damaging	Het
Ctbp2	G	A	7: 133,014,726	S160F	possibly damaging	Het
Cyp1a1	C	A	9: 57,700,293	T68K	probably damaging	Het
Dlgap2	T	A	8: 14,778,374	M594K	probably benign	Het
Dnah6	C	T	6: 73,212,522	E48K	probably benign	Het
Dock2	A	G	11: 34,756,222	V35A	probably damaging	Het
E330009J07Rik	T	C	6: 40,406,917	N397S	possibly damaging	Het
Edem2	A	T	2: 155,726,674	S73R	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Frem2	T	C	3: 53,516,821	N3065S	probably damaging	Het
Gal3st4	A	T	5: 138,270,828	S123R	possibly damaging	Het
Garnl3	T	A	2: 32,986,829	I937F	possibly damaging	Het
Gfod2	C	T	8: 105,717,363	V183M	possibly damaging	Het
Glipr1l1	T	C	10: 112,062,434		probably null	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm7145	T	G	1: 117,985,981	C198G	probably damaging	Het
Gm906	G	T	13: 50,245,257	P1011H	probably damaging	Het
H2-Eb2	G	A	17: 34,333,549	A123T	possibly damaging	Het
Ighv1-55	T	C	12: 115,208,509	I7V	probably benign	Het
Itpripl2	G	T	7: 118,491,109	P76T	possibly damaging	Het
Kat6a	C	A	8: 22,903,199	A231E	possibly damaging	Het
Lipo1	C	T	19: 33,780,305	V255I	probably benign	Het
Mamstr	A	T	7: 45,643,238	M141L	probably benign	Het
Med13	A	G	11: 86,319,876	V480A	probably benign	Het
Mei1	A	G	15: 82,089,609	N523S	probably benign	Het
Mill2	A	G	7: 18,856,426	T144A	probably null	Het
Muc16	C	A	9: 18,642,663	L4111F	unknown	Het
Mylk2	G	A	2: 152,913,690	G258E	possibly damaging	Het
Myom2	T	G	8: 15,065,710	S42A	probably benign	Het
Nab1	C	A	1: 52,464,836	G401C	possibly damaging	Het
Nifk	T	C	1: 118,332,862	V244A	possibly damaging	Het
Nipsnap2	C	A	5: 129,753,293	Q224K	probably benign	Het
Nop16	T	G	13: 54,589,740	K47Q	probably damaging	Het
Nup153	A	T	13: 46,699,716	S548R	probably damaging	Het
Olfr1284	A	G	2: 111,379,002	M1V	probably null	Het
Olfr1465	A	G	19: 13,313,634	I217T	probably benign	Het
Olfr521	A	C	7: 99,767,717	D185A	probably damaging	Het
Pard6g	G	A	18: 80,117,319	V216I	possibly damaging	Het
Pcdh20	C	T	14: 88,468,602	V421I	probably benign	Het
Pcif1	G	A	2: 164,884,304		probably null	Het
Pde11a	C	A	2: 76,337,740	V290F	probably damaging	Het
Pisd	T	C	5: 32,737,429	Y511C	probably damaging	Het
Polg	A	T	7: 79,460,657	D276E	probably damaging	Het
Polr3b	T	C	10: 84,713,632	V906A	probably damaging	Het
Prkcg	C	T	7: 3,313,819	P270S	probably benign	Het
Rapgef2	T	A	3: 79,085,974	I884F	probably damaging	Het
Rpl13	C	A	8: 123,103,275	N113K	possibly damaging	Het
Rxra	T	A	2: 27,741,174	I139N	probably damaging	Het
Sf3b5	T	A	10: 13,008,743	C41S	probably benign	Het
Stk24	C	T	14: 121,302,809	R126Q	probably damaging	Het
Taar8b	T	C	10: 24,092,065	D77G	possibly damaging	Het
Tbc1d1	T	A	5: 64,311,109	C566S	probably benign	Het
Tenm3	A	T	8: 48,298,937	M948K	probably damaging	Het
Thbs4	T	A	13: 92,757,936	Q693L	possibly damaging	Het
Tnfrsf26	A	T	7: 143,618,389	C61*	probably null	Het
Trp63	A	G	16: 25,889,168	E636G	probably damaging	Het
Try5	T	C	6: 41,311,332	Y121C	probably damaging	Het
Ttn	G	T	2: 76,830,411		probably benign	Het
Vamp1	T	A	6: 125,218,945	V55D	probably damaging	Het
Vmn2r117	T	C	17: 23,479,563	N12S	probably damaging	Het
Vmn2r90	G	A	17: 17,704,061	G41S	probably damaging	Het
Zfp462	T	A	4: 55,007,775	D71E	probably benign	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATACAATTGGCTTTCTCACTGTGTC -3'
(R):5'- CACTCCTCAGTGTAAGCTACCC -3'

Sequencing Primer
(F):5'- GTCTTCTGTTTAATGTTCAGACAGTC -3'
(R):5'- AGTGTAAGCTACCCTCAGACTTTG -3'

Posted On

2018-11-06