Incidental Mutation 'R6913:Trp63'
ID539206
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Nametransformation related protein 63
SynonymsTAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location25683763-25892102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25889168 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 636 (E636G)
Ref Sequence ENSEMBL: ENSMUSP00000110965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040231] [ENSMUST00000065523] [ENSMUST00000115306] [ENSMUST00000115310]
Predicted Effect probably damaging
Transcript: ENSMUST00000040231
AA Change: E542G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038117
Gene: ENSMUSG00000022510
AA Change: E542G

DomainStartEndE-ValueType
Pfam:P53 69 265 5.4e-110 PFAM
Pfam:P53_tetramer 297 338 2.4e-20 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
SAM 447 513 1.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065523
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115306
AA Change: E538G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110961
Gene: ENSMUSG00000022510
AA Change: E538G

DomainStartEndE-ValueType
Pfam:P53 69 265 2.7e-110 PFAM
Pfam:P53_tetramer 293 334 9.2e-21 PFAM
low complexity region 339 352 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
SAM 443 509 1.4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115310
AA Change: E636G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: E636G

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Meta Mutation Damage Score 0.1017 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4689:Trp63 UTSW 16 25865262 missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5033:Trp63 UTSW 16 25763306 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5354:Trp63 UTSW 16 25684355 splice site probably null
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6029:Trp63 UTSW 16 25868214 missense probably damaging 1.00
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6980:Trp63 UTSW 16 25802093 missense probably benign
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7544:Trp63 UTSW 16 25802087 missense probably benign
R7690:Trp63 UTSW 16 25876733 missense unknown
R7743:Trp63 UTSW 16 25882625 missense probably benign 0.05
R7766:Trp63 UTSW 16 25868219 missense probably damaging 0.97
R7792:Trp63 UTSW 16 25868224 missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25889240 missense probably damaging 1.00
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTGCACAGGATTTGGCAAG -3'
(R):5'- TCCGTCCCTTTAGAAACCAGAC -3'

Sequencing Primer
(F):5'- TTGGCAAGTCTGAAGATCCC -3'
(R):5'- GTCCCTTTAGAAACCAGACTGAGAAG -3'
Posted On2018-11-06