Mutagenetix > Incidental Mutation

Incidental Mutation 'R6913:Vmn2r117'

539208

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r117

Ensembl Gene

ENSMUSG00000091407

Gene Name

vomeronasal 2, receptor 117

Synonyms

EG619788

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R6913 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23459675-23479597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23479563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 12 (N12S)

Ref Sequence

ENSEMBL: ENSMUSP00000126885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000171996]

AlphaFold

K7N6V1

Predicted Effect

probably damaging
Transcript: ENSMUST00000171996
AA Change: N12S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: N12S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.6e-28	PFAM
Pfam:NCD3G	512	565	5e-20	PFAM
Pfam:7tm_3	595	833	8.2e-54	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.9%

Validation Efficiency

97% (74/76)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	A	T	16: 20,378,744	I619N	possibly damaging	Het
Accsl	T	C	2: 93,866,143	K41E	possibly damaging	Het
Actr6	T	C	10: 89,726,696	E107G	probably damaging	Het
Adam7	T	A	14: 68,533,651	M9L	probably benign	Het
Adamts12	T	A	15: 11,215,692	H266Q	probably damaging	Het
Adamts16	A	G	13: 70,728,898	F1208S	possibly damaging	Het
Ankrd11	T	C	8: 122,894,911	D734G	probably benign	Het
Ap1b1	T	C	11: 5,012,972	V43A	possibly damaging	Het
Asnsd1	A	G	1: 53,348,231	V79A	probably damaging	Het
Aste1	T	A	9: 105,397,408	S221R	probably benign	Het
Ccndbp1	G	A	2: 121,009,866	E94K	probably benign	Het
Cdc34	G	A	10: 79,685,103		probably null	Het
Cdh16	T	C	8: 104,622,264	D67G	probably benign	Het
Chd8	T	C	14: 52,214,494	E1348G	probably damaging	Het
Chl1	C	T	6: 103,665,948	Q216*	probably null	Het
Cse1l	G	A	2: 166,929,877	V353I	possibly damaging	Het
Ctbp2	G	A	7: 133,014,726	S160F	possibly damaging	Het
Cyp1a1	C	A	9: 57,700,293	T68K	probably damaging	Het
Dlgap2	T	A	8: 14,778,374	M594K	probably benign	Het
Dnah6	C	T	6: 73,212,522	E48K	probably benign	Het
Dock2	A	G	11: 34,756,222	V35A	probably damaging	Het
E330009J07Rik	T	C	6: 40,406,917	N397S	possibly damaging	Het
Edem2	A	T	2: 155,726,674	S73R	probably damaging	Het
Eps15	T	C	4: 109,361,230	V430A	probably benign	Het
Frem2	T	C	3: 53,516,821	N3065S	probably damaging	Het
Gal3st4	A	T	5: 138,270,828	S123R	possibly damaging	Het
Garnl3	T	A	2: 32,986,829	I937F	possibly damaging	Het
Gfod2	C	T	8: 105,717,363	V183M	possibly damaging	Het
Glipr1l1	T	C	10: 112,062,434		probably null	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gm7145	T	G	1: 117,985,981	C198G	probably damaging	Het
Gm906	G	T	13: 50,245,257	P1011H	probably damaging	Het
H2-Eb2	G	A	17: 34,333,549	A123T	possibly damaging	Het
Ighv1-55	T	C	12: 115,208,509	I7V	probably benign	Het
Itpripl2	G	T	7: 118,491,109	P76T	possibly damaging	Het
Kat6a	C	A	8: 22,903,199	A231E	possibly damaging	Het
Lipo1	C	T	19: 33,780,305	V255I	probably benign	Het
Mamstr	A	T	7: 45,643,238	M141L	probably benign	Het
Med13	A	G	11: 86,319,876	V480A	probably benign	Het
Mei1	A	G	15: 82,089,609	N523S	probably benign	Het
Mill2	A	G	7: 18,856,426	T144A	probably null	Het
Muc16	C	A	9: 18,642,663	L4111F	unknown	Het
Mylk2	G	A	2: 152,913,690	G258E	possibly damaging	Het
Myom2	T	G	8: 15,065,710	S42A	probably benign	Het
Nab1	C	A	1: 52,464,836	G401C	possibly damaging	Het
Nifk	T	C	1: 118,332,862	V244A	possibly damaging	Het
Nipsnap2	C	A	5: 129,753,293	Q224K	probably benign	Het
Nop16	T	G	13: 54,589,740	K47Q	probably damaging	Het
Nup153	A	T	13: 46,699,716	S548R	probably damaging	Het
Olfr1284	A	G	2: 111,379,002	M1V	probably null	Het
Olfr1465	A	G	19: 13,313,634	I217T	probably benign	Het
Olfr521	A	C	7: 99,767,717	D185A	probably damaging	Het
Pard6g	G	A	18: 80,117,319	V216I	possibly damaging	Het
Pcdh20	C	T	14: 88,468,602	V421I	probably benign	Het
Pcif1	G	A	2: 164,884,304		probably null	Het
Pde11a	C	A	2: 76,337,740	V290F	probably damaging	Het
Pisd	T	C	5: 32,737,429	Y511C	probably damaging	Het
Polg	A	T	7: 79,460,657	D276E	probably damaging	Het
Polr3b	T	C	10: 84,713,632	V906A	probably damaging	Het
Prkcg	C	T	7: 3,313,819	P270S	probably benign	Het
Rapgef2	T	A	3: 79,085,974	I884F	probably damaging	Het
Rpl13	C	A	8: 123,103,275	N113K	possibly damaging	Het
Rxra	T	A	2: 27,741,174	I139N	probably damaging	Het
Sf3b5	T	A	10: 13,008,743	C41S	probably benign	Het
Stk24	C	T	14: 121,302,809	R126Q	probably damaging	Het
Taar8b	T	C	10: 24,092,065	D77G	possibly damaging	Het
Tbc1d1	T	A	5: 64,311,109	C566S	probably benign	Het
Tenm3	A	T	8: 48,298,937	M948K	probably damaging	Het
Thbs4	T	A	13: 92,757,936	Q693L	possibly damaging	Het
Tnfrsf26	A	T	7: 143,618,389	C61*	probably null	Het
Trp63	A	G	16: 25,889,168	E636G	probably damaging	Het
Try5	T	C	6: 41,311,332	Y121C	probably damaging	Het
Ttn	G	T	2: 76,830,411		probably benign	Het
Vamp1	T	A	6: 125,218,945	V55D	probably damaging	Het
Vmn2r90	G	A	17: 17,704,061	G41S	probably damaging	Het
Zfp462	T	A	4: 55,007,775	D71E	probably benign	Het

Other mutations in Vmn2r117

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r117	APN	17	23477840	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23475429	missense	probably damaging	1.00
IGL00990:Vmn2r117	APN	17	23479546	missense	probably benign
IGL01078:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01139:Vmn2r117	APN	17	23477804	missense	probably damaging	1.00
IGL01374:Vmn2r117	APN	17	23478382	missense	possibly damaging	0.46
IGL01779:Vmn2r117	APN	17	23477241	missense	probably benign	0.00
IGL02283:Vmn2r117	APN	17	23475382	missense	probably damaging	0.99
IGL02527:Vmn2r117	APN	17	23477225	missense	possibly damaging	0.65
IGL02612:Vmn2r117	APN	17	23459784	missense	possibly damaging	0.91
IGL02887:Vmn2r117	APN	17	23475578	splice site	probably benign
IGL03167:Vmn2r117	APN	17	23477707	missense	probably damaging	1.00
R0315:Vmn2r117	UTSW	17	23460165	missense	probably benign	0.11
R0610:Vmn2r117	UTSW	17	23475514	missense	probably benign	0.00
R0747:Vmn2r117	UTSW	17	23475503	nonsense	probably null
R1411:Vmn2r117	UTSW	17	23460553	missense	probably damaging	1.00
R1471:Vmn2r117	UTSW	17	23478473	missense	probably benign	0.00
R1853:Vmn2r117	UTSW	17	23477455	missense	probably damaging	0.99
R1925:Vmn2r117	UTSW	17	23478389	missense	probably benign	0.00
R1940:Vmn2r117	UTSW	17	23477480	missense	probably damaging	1.00
R2005:Vmn2r117	UTSW	17	23477644	missense	probably damaging	1.00
R2082:Vmn2r117	UTSW	17	23460256	missense	possibly damaging	0.55
R2698:Vmn2r117	UTSW	17	23459911	missense	probably damaging	0.98
R2972:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2973:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R2974:Vmn2r117	UTSW	17	23459856	missense	probably damaging	1.00
R3160:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3161:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3162:Vmn2r117	UTSW	17	23460378	missense	probably damaging	1.00
R3847:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R3848:Vmn2r117	UTSW	17	23460415	missense	probably damaging	0.97
R4082:Vmn2r117	UTSW	17	23460106	missense	probably benign	0.00
R4320:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R4560:Vmn2r117	UTSW	17	23459877	missense	probably damaging	1.00
R4658:Vmn2r117	UTSW	17	23478416	missense	probably benign	0.01
R4881:Vmn2r117	UTSW	17	23477885	missense	probably damaging	1.00
R4908:Vmn2r117	UTSW	17	23459838	missense	probably damaging	1.00
R4910:Vmn2r117	UTSW	17	23479513	frame shift	probably null
R5078:Vmn2r117	UTSW	17	23460148	missense	probably damaging	1.00
R5327:Vmn2r117	UTSW	17	23477874	nonsense	probably null
R5774:Vmn2r117	UTSW	17	23477202	missense	probably damaging	0.98
R6014:Vmn2r117	UTSW	17	23479561	missense	probably damaging	0.97
R6390:Vmn2r117	UTSW	17	23460114	missense	possibly damaging	0.95
R6520:Vmn2r117	UTSW	17	23460219	missense	probably damaging	0.99
R6674:Vmn2r117	UTSW	17	23460049	nonsense	probably null
R6736:Vmn2r117	UTSW	17	23478308	missense	probably damaging	0.99
R6909:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
R7220:Vmn2r117	UTSW	17	23477203	missense	probably damaging	1.00
R7260:Vmn2r117	UTSW	17	23475385	missense	probably benign	0.06
R7440:Vmn2r117	UTSW	17	23475565	missense	probably benign	0.26
R7443:Vmn2r117	UTSW	17	23460133	missense	probably benign	0.25
R7443:Vmn2r117	UTSW	17	23460345	missense	probably damaging	1.00
R7449:Vmn2r117	UTSW	17	23459895	missense	probably damaging	1.00
R7644:Vmn2r117	UTSW	17	23477291	missense	probably damaging	0.98
R7914:Vmn2r117	UTSW	17	23460126	missense	possibly damaging	0.95
R8001:Vmn2r117	UTSW	17	23479407	missense	possibly damaging	0.89
R8029:Vmn2r117	UTSW	17	23477770	missense	probably benign	0.00
R8340:Vmn2r117	UTSW	17	23460537	missense	probably benign	0.01
R8519:Vmn2r117	UTSW	17	23479468	missense	probably benign
R8723:Vmn2r117	UTSW	17	23477369	missense	probably damaging	1.00
R8914:Vmn2r117	UTSW	17	23460169	missense	probably benign	0.02
R9010:Vmn2r117	UTSW	17	23460471	missense	probably benign	0.10
R9129:Vmn2r117	UTSW	17	23459944	nonsense	probably null
R9244:Vmn2r117	UTSW	17	23477615	missense	probably damaging	0.98
R9464:Vmn2r117	UTSW	17	23477604	missense	probably benign	0.23
R9620:Vmn2r117	UTSW	17	23478476	missense	probably damaging	0.97
V5622:Vmn2r117	UTSW	17	23477840	missense	probably damaging	1.00
V5622:Vmn2r117	UTSW	17	23479505	missense	possibly damaging	0.67
Z1176:Vmn2r117	UTSW	17	23459766	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGGAAACATTCATGATGACTG -3'
(R):5'- TCAATGATTCCTCCAGGGGTG -3'

Sequencing Primer
(F):5'- CATGATGACTGTACATGGAAAACAC -3'
(R):5'- TTCCTCCAGGGGTGAGGAAAC -3'

Posted On

2018-11-06