Incidental Mutation 'R6913:Olfr1465'
ID539211
Institutional Source Beutler Lab
Gene Symbol Olfr1465
Ensembl Gene ENSMUSG00000062199
Gene Nameolfactory receptor 1465
SynonymsMOR202-28, GA_x6K02T2RE5P-3645346-3644423
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13312768-13315541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13313634 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 217 (I217T)
Ref Sequence ENSEMBL: ENSMUSP00000146645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080142] [ENSMUST00000207340]
Predicted Effect probably benign
Transcript: ENSMUST00000080142
AA Change: I217T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079039
Gene: ENSMUSG00000062199
AA Change: I217T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.4e-47 PFAM
Pfam:7tm_1 39 288 3.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207340
AA Change: I217T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Frem2 T C 3: 53,516,821 N3065S probably damaging Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Olfr1465
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Olfr1465 APN 19 13314126 missense probably damaging 1.00
IGL01548:Olfr1465 APN 19 13313986 missense possibly damaging 0.95
IGL02548:Olfr1465 APN 19 13313938 missense probably damaging 0.98
IGL02663:Olfr1465 APN 19 13313379 missense probably benign 0.01
BB010:Olfr1465 UTSW 19 13314205 missense probably benign
BB020:Olfr1465 UTSW 19 13314205 missense probably benign
PIT4651001:Olfr1465 UTSW 19 13314192 missense probably benign 0.12
R0563:Olfr1465 UTSW 19 13313748 missense probably benign 0.28
R1803:Olfr1465 UTSW 19 13314171 missense possibly damaging 0.90
R2146:Olfr1465 UTSW 19 13314121 missense probably benign 0.23
R4674:Olfr1465 UTSW 19 13313814 missense probably benign 0.17
R4697:Olfr1465 UTSW 19 13313717 missense probably benign 0.39
R4825:Olfr1465 UTSW 19 13314320 intron probably null
R4884:Olfr1465 UTSW 19 13313670 missense probably benign 0.28
R5647:Olfr1465 UTSW 19 13314189 missense probably damaging 1.00
R6401:Olfr1465 UTSW 19 13313514 missense probably damaging 1.00
R6996:Olfr1465 UTSW 19 13313672 missense probably benign 0.15
R7933:Olfr1465 UTSW 19 13314205 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGTAGACCAGAGGATTCAG -3'
(R):5'- CACATTGGGGACACCTTCAATC -3'

Sequencing Primer
(F):5'- TTCAGCATAGGGATGATCATGG -3'
(R):5'- GGGGACACCTTCAATCTTTCTTTCTG -3'
Posted On2018-11-06