Incidental Mutation 'R6914:Prom2'
ID 539215
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Name prominin 2
Synonyms
MMRRC Submission 045035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6914 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127368873-127383337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 127372295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 723 (I723L)
Ref Sequence ENSEMBL: ENSMUSP00000028855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
AlphaFold Q3UUY6
Predicted Effect possibly damaging
Transcript: ENSMUST00000028855
AA Change: I723L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: I723L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103214
AA Change: I723L

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: I723L

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,061,298 (GRCm39) K17* probably null Het
Abca6 T C 11: 110,081,064 (GRCm39) I1183V probably benign Het
Adap2 A G 11: 80,045,891 (GRCm39) D57G probably benign Het
Atmin G T 8: 117,683,452 (GRCm39) V371F probably benign Het
Cacna1h G T 17: 25,604,013 (GRCm39) A1273E probably benign Het
Cblb G A 16: 51,867,793 (GRCm39) E134K probably damaging Het
Ccdc158 A G 5: 92,809,929 (GRCm39) V193A probably benign Het
Cnot9 T A 1: 74,558,154 (GRCm39) V100E probably damaging Het
Cog2 T A 8: 125,271,875 (GRCm39) V463D probably benign Het
Cracd A T 5: 77,004,854 (GRCm39) Q405L unknown Het
Crybg3 C T 16: 59,360,183 (GRCm39) R2500H possibly damaging Het
Csmd3 C A 15: 47,874,534 (GRCm39) R687S possibly damaging Het
Derl3 A G 10: 75,730,050 (GRCm39) probably null Het
Dipk1c A C 18: 84,748,549 (GRCm39) Y49S possibly damaging Het
Dlc1 T C 8: 37,405,364 (GRCm39) K142E probably benign Het
Dnai1 T G 4: 41,625,176 (GRCm39) M380R probably benign Het
Gas7 A T 11: 67,550,977 (GRCm39) probably null Het
Gpt C A 15: 76,581,792 (GRCm39) Q138K probably benign Het
Greb1 T A 12: 16,757,903 (GRCm39) E748V probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
Hecw1 A C 13: 14,491,423 (GRCm39) L523R probably damaging Het
Hhatl G A 9: 121,617,246 (GRCm39) A329V probably benign Het
Homer3 C T 8: 70,744,201 (GRCm39) T276I probably benign Het
Igdcc4 G A 9: 65,027,550 (GRCm39) S204N probably benign Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Mccc2 C A 13: 100,126,858 (GRCm39) D137Y probably damaging Het
Nup42 T A 5: 24,386,082 (GRCm39) S205T probably damaging Het
Pde8b T A 13: 95,223,352 (GRCm39) M301L probably benign Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pom121 A T 5: 135,407,011 (GRCm39) F1175I probably damaging Het
Pth1r C T 9: 110,557,084 (GRCm39) probably null Het
Samd8 T C 14: 21,825,221 (GRCm39) I59T possibly damaging Het
Scgb2b18 A G 7: 32,871,564 (GRCm39) V85A possibly damaging Het
Sema6c G T 3: 95,080,519 (GRCm39) V906L probably benign Het
Sipa1l3 T C 7: 29,085,516 (GRCm39) T694A probably damaging Het
Slc26a2 A C 18: 61,332,351 (GRCm39) I360S probably damaging Het
Slc8a1 A G 17: 81,715,549 (GRCm39) L828P probably damaging Het
Spry1 T A 3: 37,697,193 (GRCm39) D145E probably benign Het
Stat6 A T 10: 127,487,131 (GRCm39) N213Y probably damaging Het
Tbx20 T C 9: 24,636,779 (GRCm39) H436R probably benign Het
Tle2 T C 10: 81,422,190 (GRCm39) Y411H probably damaging Het
Tmem45a T C 16: 56,646,145 (GRCm39) N25S probably benign Het
Trip11 T C 12: 101,812,879 (GRCm39) N1485S probably benign Het
Trrap T A 5: 144,720,853 (GRCm39) I230N possibly damaging Het
Vezt A T 10: 93,806,313 (GRCm39) H699Q probably benign Het
Vmn1r43 T A 6: 89,847,319 (GRCm39) I56F probably benign Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127,383,059 (GRCm39) missense probably benign 0.04
IGL01140:Prom2 APN 2 127,373,125 (GRCm39) splice site probably benign
IGL01300:Prom2 APN 2 127,377,009 (GRCm39) missense probably benign 0.44
IGL01445:Prom2 APN 2 127,381,433 (GRCm39) splice site probably benign
IGL01472:Prom2 APN 2 127,374,802 (GRCm39) missense probably benign 0.39
IGL01541:Prom2 APN 2 127,371,050 (GRCm39) critical splice donor site probably null
IGL01991:Prom2 APN 2 127,371,142 (GRCm39) missense probably damaging 1.00
IGL02421:Prom2 APN 2 127,373,802 (GRCm39) critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127,371,391 (GRCm39) missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127,380,577 (GRCm39) splice site probably benign
IGL02826:Prom2 APN 2 127,373,036 (GRCm39) missense probably benign 0.07
IGL02830:Prom2 APN 2 127,376,989 (GRCm39) missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127,370,734 (GRCm39) missense probably benign 0.10
R0110:Prom2 UTSW 2 127,373,033 (GRCm39) missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127,380,258 (GRCm39) splice site probably benign
R0165:Prom2 UTSW 2 127,381,434 (GRCm39) splice site probably benign
R0220:Prom2 UTSW 2 127,383,027 (GRCm39) missense probably benign 0.03
R0466:Prom2 UTSW 2 127,370,709 (GRCm39) missense probably damaging 0.99
R0505:Prom2 UTSW 2 127,374,787 (GRCm39) missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127,381,915 (GRCm39) critical splice donor site probably null
R0633:Prom2 UTSW 2 127,381,445 (GRCm39) missense probably benign 0.19
R0947:Prom2 UTSW 2 127,380,183 (GRCm39) missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127,382,082 (GRCm39) missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127,374,802 (GRCm39) missense probably damaging 1.00
R1859:Prom2 UTSW 2 127,383,017 (GRCm39) missense probably damaging 0.97
R1864:Prom2 UTSW 2 127,381,707 (GRCm39) missense probably benign 0.00
R1866:Prom2 UTSW 2 127,378,514 (GRCm39) missense probably damaging 0.99
R3824:Prom2 UTSW 2 127,377,593 (GRCm39) splice site probably benign
R4472:Prom2 UTSW 2 127,382,111 (GRCm39) missense probably benign 0.06
R5078:Prom2 UTSW 2 127,373,757 (GRCm39) missense probably benign 0.00
R5889:Prom2 UTSW 2 127,371,331 (GRCm39) missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127,372,053 (GRCm39) nonsense probably null
R6214:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6215:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R7099:Prom2 UTSW 2 127,381,698 (GRCm39) missense probably benign
R7427:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7428:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7525:Prom2 UTSW 2 127,374,701 (GRCm39) missense probably benign
R8477:Prom2 UTSW 2 127,381,124 (GRCm39) missense probably benign 0.01
R9287:Prom2 UTSW 2 127,380,185 (GRCm39) missense probably damaging 0.98
R9337:Prom2 UTSW 2 127,371,094 (GRCm39) missense probably damaging 0.99
Z1176:Prom2 UTSW 2 127,374,695 (GRCm39) missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127,381,446 (GRCm39) missense probably benign 0.19
Z1177:Prom2 UTSW 2 127,380,225 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAACACTCAGTGGCCTG -3'
(R):5'- AAGGATCCCTTTCTTAGGCCTC -3'

Sequencing Primer
(F):5'- ACTCAGTGGCCTGCAGGAAG -3'
(R):5'- TAGGCCTCTTGGTCCTAGAGC -3'
Posted On 2018-11-06