Incidental Mutation 'R6914:Gm4070'
ID539227
Institutional Source Beutler Lab
Gene Symbol Gm4070
Ensembl Gene ENSMUSG00000078606
Gene Namepredicted gene 4070
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6914 (G1)
Quality Score107.008
Status Not validated
Chromosome7
Chromosomal Location105895139-105953967 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 105901980 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 622 (Q622*)
Ref Sequence ENSEMBL: ENSMUSP00000135898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106766] [ENSMUST00000176467] [ENSMUST00000176994]
Predicted Effect probably null
Transcript: ENSMUST00000106766
AA Change: Q622*
SMART Domains Protein: ENSMUSP00000102377
Gene: ENSMUSG00000078606
AA Change: Q622*

DomainStartEndE-ValueType
low complexity region 104 116 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Blast:PGAM 860 1554 7e-61 BLAST
coiled coil region 1625 1656 N/A INTRINSIC
low complexity region 1769 1781 N/A INTRINSIC
coiled coil region 1851 1877 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176467
AA Change: Q622*
SMART Domains Protein: ENSMUSP00000135898
Gene: ENSMUSG00000078606
AA Change: Q622*

DomainStartEndE-ValueType
low complexity region 104 116 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Blast:PGAM 860 1554 7e-61 BLAST
coiled coil region 1625 1656 N/A INTRINSIC
low complexity region 1769 1781 N/A INTRINSIC
coiled coil region 1851 1877 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176994
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Gm4070
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Gm4070 APN 7 105896802 missense possibly damaging 0.52
IGL02657:Gm4070 APN 7 105896765 missense probably damaging 1.00
R0755:Gm4070 UTSW 7 105896685 missense possibly damaging 0.81
R6913:Gm4070 UTSW 7 105901980 nonsense probably null
R6921:Gm4070 UTSW 7 105901980 nonsense probably null
R6941:Gm4070 UTSW 7 105901980 nonsense probably null
R6943:Gm4070 UTSW 7 105901980 nonsense probably null
R6944:Gm4070 UTSW 7 105901980 nonsense probably null
R6945:Gm4070 UTSW 7 105901980 nonsense probably null
R7208:Gm4070 UTSW 7 105902179 missense possibly damaging 0.58
R7400:Gm4070 UTSW 7 105902040 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGCATGTCTGGCTGTTC -3'
(R):5'- GGATTAATACATGTCTCACTGATTGGG -3'

Sequencing Primer
(F):5'- TCTTTGAGGTACTTCAAGAAGGAG -3'
(R):5'- ACATGTCTCACTGATTGGGATCTGC -3'
Posted On2018-11-06