Incidental Mutation 'R6914:Homer3'
ID539229
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Namehomer scaffolding protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70282827-70294361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70291551 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 276 (T276I)
Ref Sequence ENSEMBL: ENSMUSP00000117033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect probably benign
Transcript: ENSMUST00000003669
AA Change: T279I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: T279I

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110124
AA Change: T279I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: T279I

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135368
Predicted Effect probably benign
Transcript: ENSMUST00000140212
AA Change: T276I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: T276I

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70290157 missense probably damaging 0.96
IGL02493:Homer3 APN 8 70290071 missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70286335 missense probably benign 0.00
R2436:Homer3 UTSW 8 70293056 missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70291355 missense probably benign 0.06
R4391:Homer3 UTSW 8 70290143 unclassified probably null
R4392:Homer3 UTSW 8 70290143 unclassified probably null
R4395:Homer3 UTSW 8 70290143 unclassified probably null
R4396:Homer3 UTSW 8 70290143 unclassified probably null
R4397:Homer3 UTSW 8 70290143 unclassified probably null
R4401:Homer3 UTSW 8 70290143 unclassified probably null
R4402:Homer3 UTSW 8 70290143 unclassified probably null
R4445:Homer3 UTSW 8 70290143 unclassified probably null
R4446:Homer3 UTSW 8 70290143 unclassified probably null
R4482:Homer3 UTSW 8 70290143 unclassified probably null
R4488:Homer3 UTSW 8 70290143 unclassified probably null
R4489:Homer3 UTSW 8 70290143 unclassified probably null
R4664:Homer3 UTSW 8 70290143 unclassified probably null
R4666:Homer3 UTSW 8 70290143 unclassified probably null
R4751:Homer3 UTSW 8 70285434 missense probably damaging 1.00
R5071:Homer3 UTSW 8 70291355 missense probably benign
R5828:Homer3 UTSW 8 70286306 missense probably benign 0.02
R6052:Homer3 UTSW 8 70291426 nonsense probably null
R6211:Homer3 UTSW 8 70285524 missense probably damaging 1.00
R6234:Homer3 UTSW 8 70291165 critical splice donor site probably null
R6895:Homer3 UTSW 8 70285305 missense probably damaging 0.99
R6942:Homer3 UTSW 8 70291551 missense probably benign 0.00
R7300:Homer3 UTSW 8 70285303 start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70289484 missense probably benign 0.00
R7553:Homer3 UTSW 8 70290124 missense probably benign 0.02
R7555:Homer3 UTSW 8 70289413 missense probably damaging 1.00
R7721:Homer3 UTSW 8 70291012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTCATGTCCCAGAGGATGG -3'
(R):5'- GACTGCTCAGATGTGGGAAGAC -3'

Sequencing Primer
(F):5'- TAGCAGAGCTGGAGGCC -3'
(R):5'- AGACTAAGTATGAGGTTGCTTAGC -3'
Posted On2018-11-06