Incidental Mutation 'R6914:Tbx20'
ID539232
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene NameT-box 20
SynonymsTbx12, 9430010M06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location24718138-24774303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24725483 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 436 (H436R)
Ref Sequence ENSEMBL: ENSMUSP00000052591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946]
Predicted Effect probably benign
Transcript: ENSMUST00000052946
AA Change: H436R

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: H436R

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
BB006:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
BB016:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0855:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0856:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R1981:Tbx20 UTSW 9 24770913 missense possibly damaging 0.85
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5436:Tbx20 UTSW 9 24769720 missense probably damaging 1.00
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 splice site probably null
R7731:Tbx20 UTSW 9 24770697 missense probably damaging 1.00
R7741:Tbx20 UTSW 9 24740285 splice site probably null
R7832:Tbx20 UTSW 9 24773812 missense probably damaging 1.00
R7929:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R7982:Tbx20 UTSW 9 24773924 unclassified probably benign
R8110:Tbx20 UTSW 9 24725525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTTGCGAGTCCAGCTC -3'
(R):5'- GTACCAGTACAGCATCCATAGCG -3'

Sequencing Primer
(F):5'- GCGAGTCCAGCTCTCCTC -3'
(R):5'- TCCATAGCGACACCGATTC -3'
Posted On2018-11-06