Incidental Mutation 'R6914:Pth1r'
ID 539234
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6914 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 110722085-110747145 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 110728016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000006005] [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000166716] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000196057] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000198865] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862] [ENSMUST00000199862] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect probably null
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006005
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166716
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196057
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198865
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000199862
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R2206:Pth1r UTSW 9 110723587 missense probably damaging 1.00
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4590:Pth1r UTSW 9 110722271 missense probably benign 0.04
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110727251 splice site probably null
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R8966:Pth1r UTSW 9 110725161 missense possibly damaging 0.79
R9168:Pth1r UTSW 9 110727136 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CAAATGGAGATCTGGAGCCAC -3'
(R):5'- CCAGGTTGGGAATCGTATCAG -3'

Sequencing Primer
(F):5'- ACTGAGGCTCTGAACTCCATTTTAGG -3'
(R):5'- CACGGAGACTGCAGTAAATTCTCTG -3'
Posted On 2018-11-06