Incidental Mutation 'R6914:Adap2'
ID539242
Institutional Source Beutler Lab
Gene Symbol Adap2
Ensembl Gene ENSMUSG00000020709
Gene NameArfGAP with dual PH domains 2
Synonymscentaurin alpha 2, Centa2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80154105-80178958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80155065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 57 (D57G)
Ref Sequence ENSEMBL: ENSMUSP00000130731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021050] [ENSMUST00000134118]
Predicted Effect probably benign
Transcript: ENSMUST00000021050
AA Change: D57G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021050
Gene: ENSMUSG00000020709
AA Change: D57G

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
PH 133 235 4.57e-8 SMART
PH 256 363 2.35e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134118
AA Change: D57G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130731
Gene: ENSMUSG00000020709
AA Change: D57G

DomainStartEndE-ValueType
ArfGap 9 130 1.62e-42 SMART
Meta Mutation Damage Score 0.2147 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds beta-tubulin and increases the stability of microtubules. The encoded protein can also translocate to the cell membrane and bind phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) and inositol 1,3,4,5-tetrakisphosphate (InsP4). In addition, this protein is a GTPase-activating protein for ADP ribosylation factor 6 and may be able to block the entry of some RNA viruses. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Adap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02383:Adap2 APN 11 80160189 missense probably damaging 1.00
IGL02442:Adap2 APN 11 80177206 missense probably damaging 1.00
IGL02953:Adap2 APN 11 80154300 missense probably damaging 0.99
PIT4283001:Adap2 UTSW 11 80177263 missense probably damaging 1.00
R0157:Adap2 UTSW 11 80165701 missense probably damaging 1.00
R0382:Adap2 UTSW 11 80178385 splice site probably benign
R0499:Adap2 UTSW 11 80176079 missense probably damaging 1.00
R0722:Adap2 UTSW 11 80156984 missense possibly damaging 0.86
R0828:Adap2 UTSW 11 80165664 splice site probably benign
R1938:Adap2 UTSW 11 80170682 missense probably damaging 1.00
R2268:Adap2 UTSW 11 80165726 missense probably damaging 0.99
R3103:Adap2 UTSW 11 80157033 missense probably damaging 1.00
R4621:Adap2 UTSW 11 80174073 splice site probably null
R5157:Adap2 UTSW 11 80156946 missense probably damaging 1.00
R6326:Adap2 UTSW 11 80155022 missense probably damaging 1.00
R6942:Adap2 UTSW 11 80155065 missense probably benign 0.01
R7835:Adap2 UTSW 11 80160231 missense probably benign 0.11
R8879:Adap2 UTSW 11 80156959 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCTCAGTTGTCCAAGGTTG -3'
(R):5'- GGCCTTTGCTAAGACACTGTG -3'

Sequencing Primer
(F):5'- AGAGCTTGCCTCCGACC -3'
(R):5'- TGCTAAGACACTGTGTTTCCTC -3'
Posted On2018-11-06