Incidental Mutation 'R6914:Csmd3'
ID 539251
Institutional Source Beutler Lab
Gene Symbol Csmd3
Ensembl Gene ENSMUSG00000022311
Gene Name CUB and Sushi multiple domains 3
Synonyms 4930500N14Rik
MMRRC Submission 045035-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6914 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 47444033-48655459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 47874534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 687 (R687S)
Ref Sequence ENSEMBL: ENSMUSP00000124775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100670] [ENSMUST00000160658] [ENSMUST00000162830]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000100670
AA Change: R687S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098235
Gene: ENSMUSG00000022311
AA Change: R687S

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160658
AA Change: R583S

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124753
Gene: ENSMUSG00000022311
AA Change: R583S

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
CCP 382 439 6.9e-14 SMART
CUB 444 555 9.22e-24 SMART
CCP 560 613 1.29e-13 SMART
CUB 617 725 6.87e-32 SMART
CCP 730 787 5.19e-9 SMART
CUB 791 899 3.23e-37 SMART
CCP 906 959 1.82e-13 SMART
CUB 963 1073 4.87e-23 SMART
CCP 1078 1133 1.82e-13 SMART
CUB 1137 1245 5.02e-25 SMART
CCP 1250 1306 2.5e-11 SMART
CUB 1310 1419 6.27e-26 SMART
CCP 1424 1480 4.41e-12 SMART
CUB 1484 1592 5.37e-34 SMART
CCP 1597 1654 1.18e-12 SMART
CUB 1658 1766 2.27e-23 SMART
CCP 1774 1831 1.84e-9 SMART
CUB 1835 1943 1.8e-35 SMART
CCP 1948 2003 4.48e-13 SMART
CUB 2007 2115 3.95e-32 SMART
CCP 2120 2175 4.02e-15 SMART
CUB 2179 2286 1.74e-33 SMART
CCP 2291 2348 5.82e-12 SMART
CUB 2353 2463 5.3e-24 SMART
CCP 2465 2523 2.11e-9 SMART
CCP 2528 2585 8.23e-12 SMART
CCP 2590 2643 1.14e-14 SMART
CCP 2648 2701 4.76e-17 SMART
CCP 2706 2759 1.85e-14 SMART
CCP 2764 2821 9.9e-15 SMART
CCP 2826 2879 1.79e-12 SMART
CCP 2887 2940 1.72e-14 SMART
CCP 2945 2999 3.17e-13 SMART
CCP 3004 3059 1.25e-11 SMART
CCP 3064 3117 1.25e-11 SMART
CCP 3122 3175 8.23e-12 SMART
CCP 3183 3237 5.6e-14 SMART
CCP 3242 3297 1.89e-11 SMART
transmembrane domain 3461 3483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162830
AA Change: R687S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124775
Gene: ENSMUSG00000022311
AA Change: R687S

DomainStartEndE-ValueType
CUB 65 173 8.79e-30 SMART
CCP 178 235 1.77e-11 SMART
CUB 241 345 2.29e-28 SMART
low complexity region 370 387 N/A INTRINSIC
CCP 486 543 6.9e-14 SMART
CUB 548 659 9.22e-24 SMART
CCP 664 717 1.29e-13 SMART
CUB 721 829 6.87e-32 SMART
CCP 834 891 5.19e-9 SMART
CUB 895 1003 3.23e-37 SMART
CCP 1010 1063 1.82e-13 SMART
CUB 1067 1177 4.87e-23 SMART
CCP 1182 1237 1.82e-13 SMART
CUB 1241 1349 5.02e-25 SMART
CCP 1354 1410 2.5e-11 SMART
CUB 1414 1523 6.27e-26 SMART
CCP 1528 1584 4.41e-12 SMART
CUB 1588 1696 5.37e-34 SMART
CCP 1701 1758 1.18e-12 SMART
CUB 1762 1870 2.27e-23 SMART
CCP 1878 1935 1.84e-9 SMART
CUB 1939 2047 1.8e-35 SMART
CCP 2052 2107 4.48e-13 SMART
CUB 2111 2219 3.95e-32 SMART
CCP 2224 2279 4.02e-15 SMART
CUB 2283 2390 1.74e-33 SMART
CCP 2395 2452 5.82e-12 SMART
CUB 2457 2567 5.3e-24 SMART
CCP 2569 2627 2.11e-9 SMART
CCP 2632 2689 8.23e-12 SMART
CCP 2694 2754 8.56e-10 SMART
CCP 2759 2812 1.14e-14 SMART
CCP 2817 2870 4.76e-17 SMART
CCP 2875 2928 1.85e-14 SMART
CCP 2933 2990 9.9e-15 SMART
CCP 2995 3048 1.79e-12 SMART
CCP 3056 3109 1.72e-14 SMART
CCP 3114 3168 3.17e-13 SMART
CCP 3173 3228 1.25e-11 SMART
CCP 3233 3286 1.25e-11 SMART
CCP 3291 3344 8.23e-12 SMART
CCP 3352 3406 5.6e-14 SMART
CCP 3411 3466 1.89e-11 SMART
transmembrane domain 3630 3652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,061,298 (GRCm39) K17* probably null Het
Abca6 T C 11: 110,081,064 (GRCm39) I1183V probably benign Het
Adap2 A G 11: 80,045,891 (GRCm39) D57G probably benign Het
Atmin G T 8: 117,683,452 (GRCm39) V371F probably benign Het
Cacna1h G T 17: 25,604,013 (GRCm39) A1273E probably benign Het
Cblb G A 16: 51,867,793 (GRCm39) E134K probably damaging Het
Ccdc158 A G 5: 92,809,929 (GRCm39) V193A probably benign Het
Cnot9 T A 1: 74,558,154 (GRCm39) V100E probably damaging Het
Cog2 T A 8: 125,271,875 (GRCm39) V463D probably benign Het
Cracd A T 5: 77,004,854 (GRCm39) Q405L unknown Het
Crybg3 C T 16: 59,360,183 (GRCm39) R2500H possibly damaging Het
Derl3 A G 10: 75,730,050 (GRCm39) probably null Het
Dipk1c A C 18: 84,748,549 (GRCm39) Y49S possibly damaging Het
Dlc1 T C 8: 37,405,364 (GRCm39) K142E probably benign Het
Dnai1 T G 4: 41,625,176 (GRCm39) M380R probably benign Het
Gas7 A T 11: 67,550,977 (GRCm39) probably null Het
Gpt C A 15: 76,581,792 (GRCm39) Q138K probably benign Het
Greb1 T A 12: 16,757,903 (GRCm39) E748V probably damaging Het
Gvin2 G A 7: 105,551,187 (GRCm39) Q622* probably null Het
Hecw1 A C 13: 14,491,423 (GRCm39) L523R probably damaging Het
Hhatl G A 9: 121,617,246 (GRCm39) A329V probably benign Het
Homer3 C T 8: 70,744,201 (GRCm39) T276I probably benign Het
Igdcc4 G A 9: 65,027,550 (GRCm39) S204N probably benign Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Mccc2 C A 13: 100,126,858 (GRCm39) D137Y probably damaging Het
Nup42 T A 5: 24,386,082 (GRCm39) S205T probably damaging Het
Pde8b T A 13: 95,223,352 (GRCm39) M301L probably benign Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pom121 A T 5: 135,407,011 (GRCm39) F1175I probably damaging Het
Prom2 T G 2: 127,372,295 (GRCm39) I723L possibly damaging Het
Pth1r C T 9: 110,557,084 (GRCm39) probably null Het
Samd8 T C 14: 21,825,221 (GRCm39) I59T possibly damaging Het
Scgb2b18 A G 7: 32,871,564 (GRCm39) V85A possibly damaging Het
Sema6c G T 3: 95,080,519 (GRCm39) V906L probably benign Het
Sipa1l3 T C 7: 29,085,516 (GRCm39) T694A probably damaging Het
Slc26a2 A C 18: 61,332,351 (GRCm39) I360S probably damaging Het
Slc8a1 A G 17: 81,715,549 (GRCm39) L828P probably damaging Het
Spry1 T A 3: 37,697,193 (GRCm39) D145E probably benign Het
Stat6 A T 10: 127,487,131 (GRCm39) N213Y probably damaging Het
Tbx20 T C 9: 24,636,779 (GRCm39) H436R probably benign Het
Tle2 T C 10: 81,422,190 (GRCm39) Y411H probably damaging Het
Tmem45a T C 16: 56,646,145 (GRCm39) N25S probably benign Het
Trip11 T C 12: 101,812,879 (GRCm39) N1485S probably benign Het
Trrap T A 5: 144,720,853 (GRCm39) I230N possibly damaging Het
Vezt A T 10: 93,806,313 (GRCm39) H699Q probably benign Het
Vmn1r43 T A 6: 89,847,319 (GRCm39) I56F probably benign Het
Other mutations in Csmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Csmd3 APN 15 48,150,891 (GRCm39) missense possibly damaging 0.61
IGL00591:Csmd3 APN 15 47,868,279 (GRCm39) missense probably damaging 1.00
IGL00668:Csmd3 APN 15 47,777,341 (GRCm39) missense probably damaging 1.00
IGL00753:Csmd3 APN 15 47,507,631 (GRCm39) missense probably damaging 1.00
IGL00773:Csmd3 APN 15 47,454,115 (GRCm39) missense probably damaging 0.96
IGL00926:Csmd3 APN 15 47,574,360 (GRCm39) missense possibly damaging 0.87
IGL00942:Csmd3 APN 15 47,710,502 (GRCm39) critical splice donor site probably null
IGL01080:Csmd3 APN 15 47,744,799 (GRCm39) missense probably benign 0.12
IGL01314:Csmd3 APN 15 47,713,151 (GRCm39) missense probably damaging 1.00
IGL01326:Csmd3 APN 15 47,713,181 (GRCm39) missense probably benign 0.06
IGL01393:Csmd3 APN 15 48,320,995 (GRCm39) missense possibly damaging 0.88
IGL01432:Csmd3 APN 15 47,596,895 (GRCm39) missense probably damaging 1.00
IGL01519:Csmd3 APN 15 47,460,246 (GRCm39) missense probably benign 0.31
IGL01530:Csmd3 APN 15 47,533,013 (GRCm39) missense probably damaging 1.00
IGL01530:Csmd3 APN 15 47,701,833 (GRCm39) missense possibly damaging 0.95
IGL01547:Csmd3 APN 15 47,747,013 (GRCm39) missense probably benign 0.41
IGL01594:Csmd3 APN 15 47,492,635 (GRCm39) missense probably benign 0.01
IGL01618:Csmd3 APN 15 47,874,479 (GRCm39) missense probably benign 0.05
IGL01670:Csmd3 APN 15 47,475,225 (GRCm39) missense probably damaging 1.00
IGL01680:Csmd3 APN 15 47,833,426 (GRCm39) missense probably damaging 1.00
IGL01734:Csmd3 APN 15 48,048,700 (GRCm39) missense probably damaging 1.00
IGL01777:Csmd3 APN 15 47,561,594 (GRCm39) missense probably benign 0.06
IGL01779:Csmd3 APN 15 47,721,290 (GRCm39) missense probably benign 0.10
IGL01820:Csmd3 APN 15 47,470,538 (GRCm39) nonsense probably null
IGL01843:Csmd3 APN 15 47,522,395 (GRCm39) splice site probably benign
IGL01919:Csmd3 APN 15 47,539,168 (GRCm39) missense possibly damaging 0.62
IGL01986:Csmd3 APN 15 47,522,591 (GRCm39) missense possibly damaging 0.82
IGL02049:Csmd3 APN 15 47,864,870 (GRCm39) missense possibly damaging 0.91
IGL02065:Csmd3 APN 15 47,530,024 (GRCm39) missense probably damaging 1.00
IGL02112:Csmd3 APN 15 48,177,265 (GRCm39) missense possibly damaging 0.95
IGL02133:Csmd3 APN 15 47,721,338 (GRCm39) missense possibly damaging 0.86
IGL02203:Csmd3 APN 15 47,713,073 (GRCm39) splice site probably null
IGL02215:Csmd3 APN 15 47,449,084 (GRCm39) missense probably damaging 1.00
IGL02234:Csmd3 APN 15 47,811,512 (GRCm39) missense probably damaging 1.00
IGL02326:Csmd3 APN 15 47,619,359 (GRCm39) splice site probably benign
IGL02478:Csmd3 APN 15 47,701,794 (GRCm39) splice site probably benign
IGL02491:Csmd3 APN 15 47,777,511 (GRCm39) splice site probably benign
IGL02598:Csmd3 APN 15 47,533,086 (GRCm39) missense probably damaging 0.98
IGL02626:Csmd3 APN 15 47,567,503 (GRCm39) splice site probably benign
IGL02696:Csmd3 APN 15 47,533,065 (GRCm39) missense probably benign 0.33
IGL02876:Csmd3 APN 15 47,469,492 (GRCm39) splice site probably benign
IGL02971:Csmd3 APN 15 47,777,325 (GRCm39) splice site probably benign
IGL03068:Csmd3 APN 15 47,710,517 (GRCm39) missense possibly damaging 0.69
IGL03087:Csmd3 APN 15 47,840,429 (GRCm39) missense probably damaging 1.00
IGL03114:Csmd3 APN 15 47,683,847 (GRCm39) missense probably damaging 0.99
IGL03146:Csmd3 APN 15 47,744,873 (GRCm39) missense probably benign 0.25
IGL03193:Csmd3 APN 15 47,492,626 (GRCm39) splice site probably benign
IGL03274:Csmd3 APN 15 47,508,900 (GRCm39) missense probably damaging 1.00
R0040:Csmd3 UTSW 15 47,497,212 (GRCm39) missense probably damaging 1.00
R0071:Csmd3 UTSW 15 47,460,217 (GRCm39) missense probably benign 0.04
R0071:Csmd3 UTSW 15 47,460,217 (GRCm39) missense probably benign 0.04
R0119:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0124:Csmd3 UTSW 15 47,454,112 (GRCm39) missense probably damaging 1.00
R0127:Csmd3 UTSW 15 47,845,326 (GRCm39) missense probably benign 0.45
R0136:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0201:Csmd3 UTSW 15 47,483,125 (GRCm39) splice site probably benign
R0240:Csmd3 UTSW 15 47,492,635 (GRCm39) missense probably benign 0.05
R0240:Csmd3 UTSW 15 47,492,635 (GRCm39) missense probably benign 0.05
R0318:Csmd3 UTSW 15 47,522,549 (GRCm39) missense probably damaging 1.00
R0369:Csmd3 UTSW 15 47,833,543 (GRCm39) missense probably damaging 1.00
R0391:Csmd3 UTSW 15 47,520,969 (GRCm39) missense probably damaging 1.00
R0499:Csmd3 UTSW 15 47,710,527 (GRCm39) missense probably benign 0.08
R0506:Csmd3 UTSW 15 48,320,907 (GRCm39) missense probably benign 0.00
R0606:Csmd3 UTSW 15 48,321,058 (GRCm39) missense probably benign
R0639:Csmd3 UTSW 15 47,777,336 (GRCm39) missense probably damaging 1.00
R0658:Csmd3 UTSW 15 47,874,543 (GRCm39) missense possibly damaging 0.66
R0673:Csmd3 UTSW 15 47,777,336 (GRCm39) missense probably damaging 1.00
R0689:Csmd3 UTSW 15 47,619,421 (GRCm39) missense probably benign 0.19
R0696:Csmd3 UTSW 15 47,710,569 (GRCm39) missense probably benign 0.01
R0799:Csmd3 UTSW 15 48,048,780 (GRCm39) splice site probably benign
R0834:Csmd3 UTSW 15 47,747,073 (GRCm39) intron probably benign
R0894:Csmd3 UTSW 15 47,721,316 (GRCm39) missense possibly damaging 0.95
R0926:Csmd3 UTSW 15 47,840,429 (GRCm39) missense probably damaging 1.00
R0943:Csmd3 UTSW 15 47,539,135 (GRCm39) missense probably damaging 0.99
R0944:Csmd3 UTSW 15 47,475,227 (GRCm39) missense probably damaging 1.00
R0967:Csmd3 UTSW 15 47,721,227 (GRCm39) missense probably null 0.89
R0973:Csmd3 UTSW 15 47,522,485 (GRCm39) missense probably damaging 1.00
R1055:Csmd3 UTSW 15 47,744,933 (GRCm39) missense probably damaging 1.00
R1066:Csmd3 UTSW 15 47,777,361 (GRCm39) missense probably damaging 1.00
R1086:Csmd3 UTSW 15 47,559,151 (GRCm39) missense probably damaging 0.99
R1103:Csmd3 UTSW 15 47,811,402 (GRCm39) missense probably damaging 1.00
R1136:Csmd3 UTSW 15 47,539,213 (GRCm39) missense probably damaging 1.00
R1139:Csmd3 UTSW 15 47,559,232 (GRCm39) missense probably damaging 1.00
R1158:Csmd3 UTSW 15 48,156,170 (GRCm39) splice site probably null
R1215:Csmd3 UTSW 15 47,868,227 (GRCm39) splice site probably null
R1233:Csmd3 UTSW 15 48,536,927 (GRCm39) missense probably damaging 1.00
R1271:Csmd3 UTSW 15 47,874,455 (GRCm39) missense probably benign 0.11
R1469:Csmd3 UTSW 15 47,532,598 (GRCm39) nonsense probably null
R1469:Csmd3 UTSW 15 47,532,598 (GRCm39) nonsense probably null
R1479:Csmd3 UTSW 15 47,721,282 (GRCm39) missense probably damaging 1.00
R1480:Csmd3 UTSW 15 47,595,325 (GRCm39) missense possibly damaging 0.90
R1526:Csmd3 UTSW 15 47,449,028 (GRCm39) critical splice donor site probably null
R1527:Csmd3 UTSW 15 47,811,483 (GRCm39) missense probably benign 0.08
R1539:Csmd3 UTSW 15 47,683,794 (GRCm39) missense probably benign 0.24
R1544:Csmd3 UTSW 15 47,475,294 (GRCm39) splice site probably null
R1548:Csmd3 UTSW 15 47,845,371 (GRCm39) missense possibly damaging 0.91
R1574:Csmd3 UTSW 15 47,559,257 (GRCm39) splice site probably null
R1574:Csmd3 UTSW 15 47,559,257 (GRCm39) splice site probably null
R1619:Csmd3 UTSW 15 47,813,346 (GRCm39) missense probably damaging 1.00
R1630:Csmd3 UTSW 15 47,701,918 (GRCm39) missense possibly damaging 0.66
R1665:Csmd3 UTSW 15 47,560,185 (GRCm39) missense probably damaging 1.00
R1680:Csmd3 UTSW 15 47,604,566 (GRCm39) missense probably damaging 1.00
R1725:Csmd3 UTSW 15 47,460,203 (GRCm39) missense probably damaging 1.00
R1743:Csmd3 UTSW 15 48,485,485 (GRCm39) missense probably damaging 1.00
R1749:Csmd3 UTSW 15 47,449,056 (GRCm39) missense probably damaging 1.00
R1752:Csmd3 UTSW 15 47,523,669 (GRCm39) missense probably benign 0.15
R1769:Csmd3 UTSW 15 47,567,505 (GRCm39) splice site probably benign
R1775:Csmd3 UTSW 15 47,763,135 (GRCm39) missense probably damaging 0.99
R1795:Csmd3 UTSW 15 47,721,316 (GRCm39) missense possibly damaging 0.95
R1819:Csmd3 UTSW 15 47,617,131 (GRCm39) missense possibly damaging 0.56
R1840:Csmd3 UTSW 15 47,470,560 (GRCm39) missense probably damaging 1.00
R1860:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R1861:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R1879:Csmd3 UTSW 15 47,520,915 (GRCm39) missense possibly damaging 0.90
R1958:Csmd3 UTSW 15 47,868,035 (GRCm39) critical splice donor site probably null
R1965:Csmd3 UTSW 15 47,713,144 (GRCm39) missense probably benign 0.15
R1970:Csmd3 UTSW 15 48,536,927 (GRCm39) missense probably damaging 1.00
R2029:Csmd3 UTSW 15 47,701,975 (GRCm39) missense probably damaging 1.00
R2051:Csmd3 UTSW 15 48,485,389 (GRCm39) critical splice donor site probably null
R2108:Csmd3 UTSW 15 47,868,257 (GRCm39) missense possibly damaging 0.81
R2132:Csmd3 UTSW 15 48,320,899 (GRCm39) missense probably benign 0.06
R2146:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2147:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2148:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2157:Csmd3 UTSW 15 47,559,183 (GRCm39) missense probably damaging 0.99
R2159:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2160:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2161:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2162:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2164:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2213:Csmd3 UTSW 15 47,683,843 (GRCm39) missense possibly damaging 0.92
R2301:Csmd3 UTSW 15 47,595,394 (GRCm39) missense probably damaging 1.00
R2302:Csmd3 UTSW 15 48,177,447 (GRCm39) missense probably benign
R2355:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2497:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2509:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2566:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2567:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2568:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2570:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2571:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R2870:Csmd3 UTSW 15 47,721,320 (GRCm39) missense probably damaging 1.00
R2870:Csmd3 UTSW 15 47,721,320 (GRCm39) missense probably damaging 1.00
R2907:Csmd3 UTSW 15 47,874,449 (GRCm39) missense probably damaging 0.99
R3116:Csmd3 UTSW 15 47,520,995 (GRCm39) missense probably damaging 1.00
R3423:Csmd3 UTSW 15 47,710,648 (GRCm39) missense probably damaging 0.98
R3425:Csmd3 UTSW 15 47,710,648 (GRCm39) missense probably damaging 0.98
R3508:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R3746:Csmd3 UTSW 15 47,713,162 (GRCm39) missense probably benign 0.04
R3813:Csmd3 UTSW 15 48,655,209 (GRCm39) missense possibly damaging 0.82
R3832:Csmd3 UTSW 15 47,604,632 (GRCm39) frame shift probably null
R3959:Csmd3 UTSW 15 47,507,585 (GRCm39) missense probably benign 0.18
R4042:Csmd3 UTSW 15 47,477,480 (GRCm39) missense probably damaging 1.00
R4043:Csmd3 UTSW 15 47,619,362 (GRCm39) critical splice donor site probably null
R4191:Csmd3 UTSW 15 47,710,667 (GRCm39) missense probably damaging 0.99
R4192:Csmd3 UTSW 15 47,710,667 (GRCm39) missense probably damaging 0.99
R4419:Csmd3 UTSW 15 47,567,707 (GRCm39) missense probably damaging 1.00
R4426:Csmd3 UTSW 15 47,532,581 (GRCm39) missense possibly damaging 0.51
R4434:Csmd3 UTSW 15 47,763,191 (GRCm39) missense possibly damaging 0.68
R4438:Csmd3 UTSW 15 47,763,191 (GRCm39) missense possibly damaging 0.68
R4490:Csmd3 UTSW 15 48,177,429 (GRCm39) missense possibly damaging 0.83
R4562:Csmd3 UTSW 15 47,763,240 (GRCm39) missense probably benign 0.32
R4604:Csmd3 UTSW 15 47,868,211 (GRCm39) missense possibly damaging 0.90
R4620:Csmd3 UTSW 15 47,449,149 (GRCm39) missense probably benign 0.09
R4632:Csmd3 UTSW 15 47,874,605 (GRCm39) missense probably damaging 0.99
R4679:Csmd3 UTSW 15 48,024,479 (GRCm39) nonsense probably null
R4696:Csmd3 UTSW 15 47,777,364 (GRCm39) missense probably benign 0.24
R4718:Csmd3 UTSW 15 47,561,546 (GRCm39) nonsense probably null
R4723:Csmd3 UTSW 15 47,532,556 (GRCm39) missense probably benign 0.29
R4801:Csmd3 UTSW 15 47,484,688 (GRCm39) missense probably damaging 1.00
R4802:Csmd3 UTSW 15 47,484,688 (GRCm39) missense probably damaging 1.00
R4806:Csmd3 UTSW 15 48,177,464 (GRCm39) missense probably benign
R4816:Csmd3 UTSW 15 47,721,330 (GRCm39) missense possibly damaging 0.68
R4935:Csmd3 UTSW 15 48,024,480 (GRCm39) missense probably damaging 1.00
R4955:Csmd3 UTSW 15 48,536,914 (GRCm39) missense probably damaging 0.99
R4991:Csmd3 UTSW 15 47,864,874 (GRCm39) missense probably damaging 1.00
R5031:Csmd3 UTSW 15 47,522,588 (GRCm39) missense probably damaging 1.00
R5034:Csmd3 UTSW 15 47,492,683 (GRCm39) missense possibly damaging 0.94
R5035:Csmd3 UTSW 15 47,454,175 (GRCm39) missense probably damaging 1.00
R5120:Csmd3 UTSW 15 48,536,891 (GRCm39) nonsense probably null
R5224:Csmd3 UTSW 15 47,752,080 (GRCm39) missense possibly damaging 0.91
R5235:Csmd3 UTSW 15 47,492,674 (GRCm39) missense probably benign 0.20
R5279:Csmd3 UTSW 15 48,655,340 (GRCm39) splice site probably null
R5360:Csmd3 UTSW 15 47,532,599 (GRCm39) missense probably damaging 0.99
R5365:Csmd3 UTSW 15 47,868,145 (GRCm39) missense possibly damaging 0.68
R5379:Csmd3 UTSW 15 47,499,846 (GRCm39) nonsense probably null
R5381:Csmd3 UTSW 15 47,604,611 (GRCm39) missense probably benign 0.21
R5393:Csmd3 UTSW 15 47,497,099 (GRCm39) missense probably damaging 1.00
R5413:Csmd3 UTSW 15 47,701,831 (GRCm39) missense probably damaging 1.00
R5549:Csmd3 UTSW 15 48,048,753 (GRCm39) missense probably damaging 0.98
R5550:Csmd3 UTSW 15 48,048,753 (GRCm39) missense probably damaging 0.98
R5551:Csmd3 UTSW 15 48,177,492 (GRCm39) missense probably benign 0.13
R5567:Csmd3 UTSW 15 47,508,864 (GRCm39) missense possibly damaging 0.92
R5621:Csmd3 UTSW 15 48,177,374 (GRCm39) missense possibly damaging 0.84
R5668:Csmd3 UTSW 15 47,559,151 (GRCm39) missense possibly damaging 0.48
R5677:Csmd3 UTSW 15 48,485,447 (GRCm39) missense probably damaging 0.98
R5701:Csmd3 UTSW 15 48,403,729 (GRCm39) missense probably damaging 0.99
R5701:Csmd3 UTSW 15 47,513,617 (GRCm39) missense probably damaging 1.00
R5871:Csmd3 UTSW 15 47,752,112 (GRCm39) missense probably damaging 0.98
R5872:Csmd3 UTSW 15 47,445,923 (GRCm39) missense probably damaging 1.00
R5874:Csmd3 UTSW 15 47,507,666 (GRCm39) missense probably damaging 1.00
R5952:Csmd3 UTSW 15 47,596,901 (GRCm39) missense probably damaging 0.98
R5956:Csmd3 UTSW 15 48,655,278 (GRCm39) missense possibly damaging 0.84
R5966:Csmd3 UTSW 15 47,713,135 (GRCm39) missense probably damaging 0.96
R5969:Csmd3 UTSW 15 47,811,386 (GRCm39) missense probably damaging 1.00
R5989:Csmd3 UTSW 15 47,454,160 (GRCm39) missense possibly damaging 0.69
R6017:Csmd3 UTSW 15 48,177,408 (GRCm39) missense possibly damaging 0.95
R6057:Csmd3 UTSW 15 47,618,787 (GRCm39) missense probably damaging 1.00
R6127:Csmd3 UTSW 15 47,513,624 (GRCm39) missense probably damaging 1.00
R6178:Csmd3 UTSW 15 48,536,854 (GRCm39) missense probably damaging 1.00
R6198:Csmd3 UTSW 15 48,177,273 (GRCm39) missense probably benign 0.28
R6213:Csmd3 UTSW 15 47,492,656 (GRCm39) missense probably damaging 1.00
R6256:Csmd3 UTSW 15 47,533,125 (GRCm39) missense probably damaging 1.00
R6274:Csmd3 UTSW 15 47,484,833 (GRCm39) missense probably benign
R6327:Csmd3 UTSW 15 47,744,783 (GRCm39) missense probably damaging 1.00
R6354:Csmd3 UTSW 15 47,744,885 (GRCm39) missense probably damaging 1.00
R6405:Csmd3 UTSW 15 47,683,767 (GRCm39) missense probably damaging 0.99
R6410:Csmd3 UTSW 15 48,536,803 (GRCm39) missense probably damaging 1.00
R6416:Csmd3 UTSW 15 48,536,956 (GRCm39) missense probably damaging 1.00
R6463:Csmd3 UTSW 15 47,539,875 (GRCm39) missense probably damaging 1.00
R6536:Csmd3 UTSW 15 47,701,863 (GRCm39) missense probably damaging 1.00
R6625:Csmd3 UTSW 15 47,470,471 (GRCm39) missense probably benign 0.02
R6695:Csmd3 UTSW 15 47,721,230 (GRCm39) missense probably damaging 0.99
R6895:Csmd3 UTSW 15 47,529,910 (GRCm39) splice site probably null
R6906:Csmd3 UTSW 15 47,710,569 (GRCm39) missense probably benign 0.01
R6920:Csmd3 UTSW 15 47,507,601 (GRCm39) missense probably damaging 1.00
R7024:Csmd3 UTSW 15 47,574,387 (GRCm39) missense probably damaging 1.00
R7178:Csmd3 UTSW 15 47,454,170 (GRCm39) missense
R7192:Csmd3 UTSW 15 47,567,633 (GRCm39) missense
R7220:Csmd3 UTSW 15 48,320,994 (GRCm39) missense probably damaging 0.99
R7362:Csmd3 UTSW 15 47,619,388 (GRCm39) missense possibly damaging 0.65
R7380:Csmd3 UTSW 15 47,450,361 (GRCm39) missense
R7397:Csmd3 UTSW 15 47,559,130 (GRCm39) missense
R7467:Csmd3 UTSW 15 47,492,640 (GRCm39) missense
R7585:Csmd3 UTSW 15 48,485,471 (GRCm39) missense possibly damaging 0.76
R7623:Csmd3 UTSW 15 47,813,334 (GRCm39) missense
R7649:Csmd3 UTSW 15 47,532,539 (GRCm39) missense
R7691:Csmd3 UTSW 15 47,604,569 (GRCm39) missense
R7695:Csmd3 UTSW 15 47,683,777 (GRCm39) missense
R7759:Csmd3 UTSW 15 47,561,569 (GRCm39) missense
R7817:Csmd3 UTSW 15 47,721,356 (GRCm39) missense probably damaging 0.99
R8052:Csmd3 UTSW 15 47,569,783 (GRCm39) missense
R8089:Csmd3 UTSW 15 47,532,603 (GRCm39) missense
R8110:Csmd3 UTSW 15 47,507,666 (GRCm39) missense probably damaging 1.00
R8152:Csmd3 UTSW 15 47,532,860 (GRCm39) splice site probably null
R8323:Csmd3 UTSW 15 47,561,547 (GRCm39) missense
R8341:Csmd3 UTSW 15 47,561,547 (GRCm39) missense
R8353:Csmd3 UTSW 15 47,813,349 (GRCm39) missense probably damaging 1.00
R8364:Csmd3 UTSW 15 48,536,837 (GRCm39) missense probably damaging 1.00
R8405:Csmd3 UTSW 15 47,619,379 (GRCm39) missense probably damaging 1.00
R8412:Csmd3 UTSW 15 47,499,794 (GRCm39) missense
R8436:Csmd3 UTSW 15 47,868,218 (GRCm39) missense probably damaging 0.97
R8516:Csmd3 UTSW 15 47,492,761 (GRCm39) nonsense probably null
R8553:Csmd3 UTSW 15 47,484,724 (GRCm39) missense possibly damaging 0.52
R8554:Csmd3 UTSW 15 47,507,538 (GRCm39) missense probably benign 0.32
R8678:Csmd3 UTSW 15 47,499,849 (GRCm39) missense
R8751:Csmd3 UTSW 15 47,845,402 (GRCm39) missense
R8758:Csmd3 UTSW 15 47,469,593 (GRCm39) missense
R8768:Csmd3 UTSW 15 47,561,572 (GRCm39) missense
R8785:Csmd3 UTSW 15 48,177,482 (GRCm39) missense probably benign 0.00
R8788:Csmd3 UTSW 15 47,470,513 (GRCm39) missense
R8798:Csmd3 UTSW 15 47,595,382 (GRCm39) missense
R8801:Csmd3 UTSW 15 48,321,024 (GRCm39) missense possibly damaging 0.70
R8811:Csmd3 UTSW 15 47,560,139 (GRCm39) missense
R8844:Csmd3 UTSW 15 48,536,815 (GRCm39) missense probably damaging 0.98
R8844:Csmd3 UTSW 15 47,604,590 (GRCm39) missense probably damaging 0.96
R8892:Csmd3 UTSW 15 47,604,634 (GRCm39) missense
R8897:Csmd3 UTSW 15 48,222,739 (GRCm39) missense probably benign 0.06
R9001:Csmd3 UTSW 15 47,596,901 (GRCm39) missense
R9007:Csmd3 UTSW 15 47,751,892 (GRCm39) intron probably benign
R9016:Csmd3 UTSW 15 47,522,438 (GRCm39) missense
R9039:Csmd3 UTSW 15 47,483,308 (GRCm39) splice site probably benign
R9109:Csmd3 UTSW 15 47,617,187 (GRCm39) missense
R9121:Csmd3 UTSW 15 47,683,774 (GRCm39) missense
R9155:Csmd3 UTSW 15 47,449,051 (GRCm39) missense
R9176:Csmd3 UTSW 15 47,864,937 (GRCm39) missense
R9281:Csmd3 UTSW 15 47,460,272 (GRCm39) missense
R9298:Csmd3 UTSW 15 47,617,187 (GRCm39) missense
R9304:Csmd3 UTSW 15 47,569,805 (GRCm39) missense
R9343:Csmd3 UTSW 15 48,015,001 (GRCm39) missense probably damaging 1.00
R9367:Csmd3 UTSW 15 47,567,564 (GRCm39) missense
R9405:Csmd3 UTSW 15 47,539,187 (GRCm39) missense
R9448:Csmd3 UTSW 15 47,460,315 (GRCm39) missense
R9460:Csmd3 UTSW 15 47,617,130 (GRCm39) missense
R9481:Csmd3 UTSW 15 47,470,459 (GRCm39) missense
R9520:Csmd3 UTSW 15 47,561,608 (GRCm39) missense
R9551:Csmd3 UTSW 15 48,655,356 (GRCm39) start gained probably benign
R9552:Csmd3 UTSW 15 48,655,356 (GRCm39) start gained probably benign
R9568:Csmd3 UTSW 15 48,150,942 (GRCm39) missense probably damaging 0.97
R9571:Csmd3 UTSW 15 48,655,398 (GRCm39) start gained probably benign
R9607:Csmd3 UTSW 15 47,618,811 (GRCm39) missense probably damaging 0.98
R9621:Csmd3 UTSW 15 47,713,116 (GRCm39) missense
R9671:Csmd3 UTSW 15 47,845,299 (GRCm39) missense
R9718:Csmd3 UTSW 15 47,560,083 (GRCm39) missense
U24488:Csmd3 UTSW 15 47,573,795 (GRCm39) missense probably damaging 1.00
V8831:Csmd3 UTSW 15 48,321,092 (GRCm39) missense probably damaging 0.96
X0021:Csmd3 UTSW 15 47,833,489 (GRCm39) nonsense probably null
Z1088:Csmd3 UTSW 15 47,710,677 (GRCm39) missense probably damaging 0.98
Z1088:Csmd3 UTSW 15 47,499,789 (GRCm39) missense probably damaging 1.00
Z1177:Csmd3 UTSW 15 47,596,813 (GRCm39) missense
Z1177:Csmd3 UTSW 15 47,539,130 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GTATCACAAAGTGCTCCTCATTC -3'
(R):5'- TGGAAACCCCATCCTTCTGC -3'

Sequencing Primer
(F):5'- GGTTCCAGCTCTTTGCAATTAATTAC -3'
(R):5'- GCTCTCAAGTATCATCACATTAAACG -3'
Posted On 2018-11-06