Incidental Mutation 'R6914:Cblb'
ID539253
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52047430 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 134 (E134K)
Ref Sequence ENSEMBL: ENSMUSP00000153787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]
Predicted Effect probably damaging
Transcript: ENSMUST00000114471
AA Change: E134K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: E134K

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226593
AA Change: E134K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227062
AA Change: E134K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000227756
Predicted Effect probably damaging
Transcript: ENSMUST00000227879
AA Change: E134K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4074 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
R8167:Cblb UTSW 16 52166002 missense probably benign 0.13
R8236:Cblb UTSW 16 52166029 missense possibly damaging 0.85
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGTGCCAAAATCCCAAGCTTC -3'
(R):5'- GCTCAGGTTCGACATTCTACC -3'

Sequencing Primer
(F):5'- TGCCAAAATCCCAAGCTTCAGTTG -3'
(R):5'- AGGTTCGACATTCTACCTCAAC -3'
Posted On2018-11-06