Incidental Mutation 'R6915:Klhl20'
ID 539261
Institutional Source Beutler Lab
Gene Symbol Klhl20
Ensembl Gene ENSMUSG00000026705
Gene Name kelch-like 20
Synonyms D930050H05Rik
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.613) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 160915945-160959078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 160921266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 63 (D63G)
Ref Sequence ENSEMBL: ENSMUSP00000141213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]
AlphaFold Q8VCK5
Predicted Effect possibly damaging
Transcript: ENSMUST00000111611
AA Change: D572G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: D572G

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117467
AA Change: D572G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: D572G

DomainStartEndE-ValueType
BTB 63 160 2.73e-31 SMART
BACK 165 267 1.98e-41 SMART
Kelch 314 360 8.45e-16 SMART
Kelch 361 408 1.35e-14 SMART
Kelch 409 455 5.12e-15 SMART
Kelch 456 502 1.22e-12 SMART
Kelch 503 549 1.35e-14 SMART
Kelch 550 596 1.59e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195584
AA Change: D63G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705
AA Change: D63G

DomainStartEndE-ValueType
Kelch 1 40 1.43e-4 SMART
Kelch 41 87 1.59e-11 SMART
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Klhl20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Klhl20 APN 1 160,937,325 (GRCm39) missense probably benign 0.00
IGL00903:Klhl20 APN 1 160,918,076 (GRCm39) missense probably benign 0.00
IGL01574:Klhl20 APN 1 160,921,296 (GRCm39) missense probably damaging 1.00
IGL01721:Klhl20 APN 1 160,923,157 (GRCm39) missense probably damaging 1.00
IGL01933:Klhl20 APN 1 160,934,357 (GRCm39) missense probably damaging 1.00
IGL02187:Klhl20 APN 1 160,937,280 (GRCm39) missense probably benign 0.05
IGL02634:Klhl20 APN 1 160,925,935 (GRCm39) missense probably damaging 0.98
IGL02691:Klhl20 APN 1 160,934,444 (GRCm39) splice site probably benign
R0102:Klhl20 UTSW 1 160,918,015 (GRCm39) nonsense probably null
R0102:Klhl20 UTSW 1 160,918,015 (GRCm39) nonsense probably null
R0639:Klhl20 UTSW 1 160,921,281 (GRCm39) missense probably damaging 1.00
R1730:Klhl20 UTSW 1 160,930,560 (GRCm39) missense possibly damaging 0.82
R1856:Klhl20 UTSW 1 160,934,312 (GRCm39) missense probably benign 0.00
R2016:Klhl20 UTSW 1 160,930,608 (GRCm39) missense probably damaging 0.98
R2901:Klhl20 UTSW 1 160,937,122 (GRCm39) nonsense probably null
R4822:Klhl20 UTSW 1 160,921,333 (GRCm39) nonsense probably null
R4830:Klhl20 UTSW 1 160,925,946 (GRCm39) missense probably benign 0.00
R4894:Klhl20 UTSW 1 160,937,102 (GRCm39) missense possibly damaging 0.76
R4981:Klhl20 UTSW 1 160,930,575 (GRCm39) missense possibly damaging 0.48
R5018:Klhl20 UTSW 1 160,929,156 (GRCm39) missense probably damaging 0.98
R5023:Klhl20 UTSW 1 160,936,790 (GRCm39) critical splice donor site probably null
R5108:Klhl20 UTSW 1 160,926,820 (GRCm39) missense probably damaging 0.99
R5216:Klhl20 UTSW 1 160,921,249 (GRCm39) critical splice donor site probably null
R5659:Klhl20 UTSW 1 160,918,040 (GRCm39) missense probably damaging 1.00
R6159:Klhl20 UTSW 1 160,933,037 (GRCm39) missense probably damaging 1.00
R6836:Klhl20 UTSW 1 160,932,976 (GRCm39) missense probably benign 0.18
R6914:Klhl20 UTSW 1 160,921,266 (GRCm39) missense possibly damaging 0.50
R6920:Klhl20 UTSW 1 160,921,266 (GRCm39) missense possibly damaging 0.50
R7706:Klhl20 UTSW 1 160,936,827 (GRCm39) missense probably benign 0.01
R7976:Klhl20 UTSW 1 160,934,307 (GRCm39) missense probably benign 0.02
R7991:Klhl20 UTSW 1 160,934,434 (GRCm39) missense possibly damaging 0.89
R8085:Klhl20 UTSW 1 160,921,354 (GRCm39) missense probably damaging 1.00
R8118:Klhl20 UTSW 1 160,925,971 (GRCm39) splice site probably null
R8204:Klhl20 UTSW 1 160,934,414 (GRCm39) missense probably benign 0.04
R8678:Klhl20 UTSW 1 160,936,997 (GRCm39) missense probably damaging 1.00
R9093:Klhl20 UTSW 1 160,923,231 (GRCm39) nonsense probably null
R9094:Klhl20 UTSW 1 160,933,055 (GRCm39) missense probably damaging 1.00
R9360:Klhl20 UTSW 1 160,921,269 (GRCm39) missense probably benign 0.06
R9532:Klhl20 UTSW 1 160,937,329 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTCCCCAGCAGGATATGAC -3'
(R):5'- ATCTGAGCGTCTCCCTAGAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- TAGAGACTGTGAATTCCCCGC -3'
Posted On 2018-11-06