Mutagenetix > Incidental Mutations

Incidental Mutation 'R6915:Klhl20'

539261

Institutional Source

Beutler Lab

Gene Symbol

Klhl20

Ensembl Gene

ENSMUSG00000026705

Gene Name

kelch-like 20

Synonyms

D930050H05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R6915 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

161088375-161131511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 161093696 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 63 (D63G)

Ref Sequence

ENSEMBL: ENSMUSP00000141213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111611] [ENSMUST00000117467] [ENSMUST00000195584]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111611
AA Change: D572G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107238
Gene: ENSMUSG00000026705
AA Change: D572G

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117467
AA Change: D572G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000114044
Gene: ENSMUSG00000026705
AA Change: D572G

Domain	Start	End	E-Value	Type
BTB	63	160	2.73e-31	SMART
BACK	165	267	1.98e-41	SMART
Kelch	314	360	8.45e-16	SMART
Kelch	361	408	1.35e-14	SMART
Kelch	409	455	5.12e-15	SMART
Kelch	456	502	1.22e-12	SMART
Kelch	503	549	1.35e-14	SMART
Kelch	550	596	1.59e-11	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195584
AA Change: D63G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000141213
Gene: ENSMUSG00000026705
AA Change: D63G

Domain	Start	End	E-Value	Type
Kelch	1	40	1.43e-4	SMART
Kelch	41	87	1.59e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit male sterility. Mice homozygous for a gene trap allele exhibit corneal vascularization and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Akap9	T	A	5: 3,960,551	M436K	probably benign	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dnm3	T	C	1: 162,318,397		probably null	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Lair1	A	T	7: 4,055,953	V12E	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pfas	C	T	11: 68,992,181	R759Q	probably benign	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tinag	T	A	9: 77,001,615	Y348F	probably damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Klhl20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Klhl20	APN	1	161109755	missense	probably benign	0.00
IGL00903:Klhl20	APN	1	161090506	missense	probably benign	0.00
IGL01574:Klhl20	APN	1	161093726	missense	probably damaging	1.00
IGL01721:Klhl20	APN	1	161095587	missense	probably damaging	1.00
IGL01933:Klhl20	APN	1	161106787	missense	probably damaging	1.00
IGL02187:Klhl20	APN	1	161109710	missense	probably benign	0.05
IGL02634:Klhl20	APN	1	161098365	missense	probably damaging	0.98
IGL02691:Klhl20	APN	1	161106874	splice site	probably benign
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0102:Klhl20	UTSW	1	161090445	nonsense	probably null
R0639:Klhl20	UTSW	1	161093711	missense	probably damaging	1.00
R1730:Klhl20	UTSW	1	161102990	missense	possibly damaging	0.82
R1856:Klhl20	UTSW	1	161106742	missense	probably benign	0.00
R2016:Klhl20	UTSW	1	161103038	missense	probably damaging	0.98
R2901:Klhl20	UTSW	1	161109552	nonsense	probably null
R4822:Klhl20	UTSW	1	161093763	nonsense	probably null
R4830:Klhl20	UTSW	1	161098376	missense	probably benign	0.00
R4894:Klhl20	UTSW	1	161109532	missense	possibly damaging	0.76
R4981:Klhl20	UTSW	1	161103005	missense	possibly damaging	0.48
R5018:Klhl20	UTSW	1	161101586	missense	probably damaging	0.98
R5023:Klhl20	UTSW	1	161109220	critical splice donor site	probably null
R5108:Klhl20	UTSW	1	161099250	missense	probably damaging	0.99
R5216:Klhl20	UTSW	1	161093679	critical splice donor site	probably null
R5659:Klhl20	UTSW	1	161090470	missense	probably damaging	1.00
R6159:Klhl20	UTSW	1	161105467	missense	probably damaging	1.00
R6836:Klhl20	UTSW	1	161105406	missense	probably benign	0.18
R6914:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R6920:Klhl20	UTSW	1	161093696	missense	possibly damaging	0.50
R7706:Klhl20	UTSW	1	161109257	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGTTTCCCCAGCAGGATATGAC -3'
(R):5'- ATCTGAGCGTCTCCCTAGAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCAGGAGG -3'
(R):5'- TAGAGACTGTGAATTCCCCGC -3'

Posted On

2018-11-06