Incidental Mutation 'R6915:Vps39'
ID 539264
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene Name VPS39 HOPS complex subunit
Synonyms Vam6, Vam6P, A230065P22Rik, mVam6
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120146942-120183618 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 120151512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 738 (Y738*)
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
AlphaFold Q8R5L3
Predicted Effect probably null
Transcript: ENSMUST00000028752
AA Change: Y727*
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: Y727*

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102501
AA Change: Y738*
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: Y738*

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120,180,719 (GRCm39) splice site probably benign
IGL01629:Vps39 APN 2 120,154,079 (GRCm39) missense probably benign 0.11
IGL01812:Vps39 APN 2 120,151,271 (GRCm39) splice site probably benign
IGL01936:Vps39 APN 2 120,153,609 (GRCm39) missense probably benign 0.23
IGL02379:Vps39 APN 2 120,154,089 (GRCm39) missense probably benign 0.17
IGL02892:Vps39 APN 2 120,153,652 (GRCm39) splice site probably benign
IGL02943:Vps39 APN 2 120,169,968 (GRCm39) missense possibly damaging 0.77
Jigsaw UTSW 2 120,163,897 (GRCm39) missense probably damaging 0.98
matryoshka UTSW 2 120,155,176 (GRCm39) missense probably damaging 1.00
R0001:Vps39 UTSW 2 120,148,534 (GRCm39) missense probably benign 0.09
R0329:Vps39 UTSW 2 120,169,268 (GRCm39) missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120,169,268 (GRCm39) missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120,176,119 (GRCm39) missense probably damaging 1.00
R1483:Vps39 UTSW 2 120,154,129 (GRCm39) missense probably damaging 1.00
R1625:Vps39 UTSW 2 120,154,106 (GRCm39) missense probably damaging 1.00
R1837:Vps39 UTSW 2 120,155,878 (GRCm39) missense probably damaging 1.00
R1839:Vps39 UTSW 2 120,155,878 (GRCm39) missense probably damaging 1.00
R1934:Vps39 UTSW 2 120,148,558 (GRCm39) missense probably damaging 1.00
R2018:Vps39 UTSW 2 120,173,708 (GRCm39) missense probably damaging 1.00
R2019:Vps39 UTSW 2 120,173,708 (GRCm39) missense probably damaging 1.00
R2178:Vps39 UTSW 2 120,154,160 (GRCm39) nonsense probably null
R2513:Vps39 UTSW 2 120,169,268 (GRCm39) missense probably damaging 1.00
R3771:Vps39 UTSW 2 120,172,497 (GRCm39) missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120,180,656 (GRCm39) missense probably benign 0.15
R4580:Vps39 UTSW 2 120,169,814 (GRCm39) missense probably benign 0.35
R4815:Vps39 UTSW 2 120,169,040 (GRCm39) missense probably benign 0.37
R4851:Vps39 UTSW 2 120,152,312 (GRCm39) intron probably benign
R4894:Vps39 UTSW 2 120,183,440 (GRCm39) missense probably damaging 1.00
R5447:Vps39 UTSW 2 120,183,413 (GRCm39) missense probably benign 0.43
R5483:Vps39 UTSW 2 120,153,564 (GRCm39) missense probably benign 0.08
R5715:Vps39 UTSW 2 120,155,717 (GRCm39) missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120,152,053 (GRCm39) intron probably benign
R5949:Vps39 UTSW 2 120,159,149 (GRCm39) missense probably benign 0.23
R5954:Vps39 UTSW 2 120,155,143 (GRCm39) missense probably damaging 1.00
R5973:Vps39 UTSW 2 120,159,186 (GRCm39) missense probably damaging 0.99
R6004:Vps39 UTSW 2 120,176,131 (GRCm39) missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120,163,897 (GRCm39) missense probably damaging 0.98
R6705:Vps39 UTSW 2 120,151,157 (GRCm39) missense probably benign 0.00
R7535:Vps39 UTSW 2 120,155,176 (GRCm39) missense probably damaging 1.00
R7780:Vps39 UTSW 2 120,155,680 (GRCm39) nonsense probably null
R7869:Vps39 UTSW 2 120,169,875 (GRCm39) missense possibly damaging 0.89
R8061:Vps39 UTSW 2 120,174,692 (GRCm39) missense probably benign 0.00
R8770:Vps39 UTSW 2 120,153,548 (GRCm39) missense probably benign
R8787:Vps39 UTSW 2 120,172,506 (GRCm39) missense probably damaging 1.00
R8933:Vps39 UTSW 2 120,169,066 (GRCm39) missense probably benign 0.00
R8962:Vps39 UTSW 2 120,174,687 (GRCm39) nonsense probably null
R9302:Vps39 UTSW 2 120,151,525 (GRCm39) splice site probably benign
R9573:Vps39 UTSW 2 120,155,179 (GRCm39) missense possibly damaging 0.89
R9610:Vps39 UTSW 2 120,172,485 (GRCm39) missense probably damaging 0.99
R9611:Vps39 UTSW 2 120,172,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAAAGCTCTTGCCTGCCC -3'
(R):5'- AGAAAGAGCAGTATTGGTGTCC -3'

Sequencing Primer
(F):5'- CCCAGCCAGCCCTGTCC -3'
(R):5'- GGCTGCTTGATTTTGCCAAAAAG -3'
Posted On 2018-11-06