Incidental Mutation 'R6915:Mcoln3'
ID 539269
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Name mucolipin 3
Synonyms Va, varitint-waddler, TRPML3, 6720490O21Rik
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 145823205-145847561 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 145843011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450]
AlphaFold Q8R4F0
Predicted Effect probably null
Transcript: ENSMUST00000039450
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 145,839,683 (GRCm39) missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 145,843,019 (GRCm39) missense probably benign 0.01
IGL01712:Mcoln3 APN 3 145,834,019 (GRCm39) unclassified probably benign
IGL02115:Mcoln3 APN 3 145,843,056 (GRCm39) missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 145,839,664 (GRCm39) missense probably benign 0.29
P4717OSA:Mcoln3 UTSW 3 145,830,504 (GRCm39) missense probably damaging 0.99
R0463:Mcoln3 UTSW 3 145,846,331 (GRCm39) nonsense probably null
R1981:Mcoln3 UTSW 3 145,846,345 (GRCm39) nonsense probably null
R2056:Mcoln3 UTSW 3 145,833,979 (GRCm39) missense probably benign 0.01
R3000:Mcoln3 UTSW 3 145,839,662 (GRCm39) missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 145,846,247 (GRCm39) missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 145,836,959 (GRCm39) missense probably benign 0.01
R4950:Mcoln3 UTSW 3 145,845,274 (GRCm39) missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 145,833,877 (GRCm39) missense probably benign 0.00
R6302:Mcoln3 UTSW 3 145,830,527 (GRCm39) missense probably benign 0.00
R6353:Mcoln3 UTSW 3 145,836,909 (GRCm39) missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 145,833,942 (GRCm39) missense probably benign
R7790:Mcoln3 UTSW 3 145,845,247 (GRCm39) missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 145,845,230 (GRCm39) missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 145,830,546 (GRCm39) missense possibly damaging 0.95
R8348:Mcoln3 UTSW 3 145,836,974 (GRCm39) missense probably damaging 1.00
R8509:Mcoln3 UTSW 3 145,830,647 (GRCm39) missense probably benign 0.00
R8708:Mcoln3 UTSW 3 145,846,276 (GRCm39) nonsense probably null
R8838:Mcoln3 UTSW 3 145,845,126 (GRCm39) missense probably damaging 1.00
R8861:Mcoln3 UTSW 3 145,845,159 (GRCm39) missense probably damaging 1.00
R8981:Mcoln3 UTSW 3 145,827,554 (GRCm39) missense probably benign
Z1176:Mcoln3 UTSW 3 145,846,221 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACCTTAGATGTCTGTGTGTTG -3'
(R):5'- AACCTCATGACGTTGGGCAG -3'

Sequencing Primer
(F):5'- CATCACTGAATCTACTGGAGGCTG -3'
(R):5'- CTGCCTGGAGGGTCAGAATAAG -3'
Posted On 2018-11-06