Incidental Mutation 'R6915:Per3'
ID 539271
Institutional Source Beutler Lab
Gene Symbol Per3
Ensembl Gene ENSMUSG00000028957
Gene Name period circadian clock 3
Synonyms 2810049O06Rik, mPer3
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 151088109-151129122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151128106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 61 (M61V)
Ref Sequence ENSEMBL: ENSMUSP00000118950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030797] [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]
AlphaFold O70361
Predicted Effect probably benign
Transcript: ENSMUST00000030797
SMART Domains Protein: ENSMUSP00000030797
Gene: ENSMUSG00000028955

DomainStartEndE-ValueType
Pfam:Synaptobrevin 15 103 4.2e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103204
AA Change: M61V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: M61V

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136398
AA Change: M61V

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957
AA Change: M61V

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 3.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Per3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Per3 APN 4 151,098,055 (GRCm39) missense probably benign 0.28
IGL02112:Per3 APN 4 151,113,640 (GRCm39) missense probably benign 0.20
IGL02428:Per3 APN 4 151,102,674 (GRCm39) critical splice donor site probably null
IGL02812:Per3 APN 4 151,108,927 (GRCm39) missense probably damaging 0.99
IGL03094:Per3 APN 4 151,093,755 (GRCm39) missense probably damaging 1.00
R0119:Per3 UTSW 4 151,109,005 (GRCm39) intron probably benign
R0565:Per3 UTSW 4 151,118,409 (GRCm39) missense probably damaging 1.00
R0671:Per3 UTSW 4 151,113,288 (GRCm39) missense probably benign 0.27
R1186:Per3 UTSW 4 151,110,595 (GRCm39) missense probably damaging 0.99
R1736:Per3 UTSW 4 151,093,705 (GRCm39) critical splice donor site probably null
R1757:Per3 UTSW 4 151,127,249 (GRCm39) critical splice acceptor site probably null
R1900:Per3 UTSW 4 151,125,883 (GRCm39) missense probably damaging 1.00
R1929:Per3 UTSW 4 151,103,342 (GRCm39) missense probably damaging 1.00
R2044:Per3 UTSW 4 151,118,395 (GRCm39) missense probably benign 0.01
R2272:Per3 UTSW 4 151,103,342 (GRCm39) missense probably damaging 1.00
R2415:Per3 UTSW 4 151,097,147 (GRCm39) missense possibly damaging 0.91
R4771:Per3 UTSW 4 151,093,716 (GRCm39) missense probably damaging 1.00
R5199:Per3 UTSW 4 151,097,352 (GRCm39) missense probably benign 0.15
R5298:Per3 UTSW 4 151,113,666 (GRCm39) missense probably damaging 1.00
R5330:Per3 UTSW 4 151,125,759 (GRCm39) missense probably damaging 1.00
R5331:Per3 UTSW 4 151,125,759 (GRCm39) missense probably damaging 1.00
R5920:Per3 UTSW 4 151,096,907 (GRCm39) missense probably benign 0.05
R5974:Per3 UTSW 4 151,127,194 (GRCm39) missense possibly damaging 0.83
R6498:Per3 UTSW 4 151,113,662 (GRCm39) missense probably benign 0.27
R6907:Per3 UTSW 4 151,128,015 (GRCm39) critical splice donor site probably null
R7269:Per3 UTSW 4 151,116,393 (GRCm39) nonsense probably null
R7454:Per3 UTSW 4 151,097,185 (GRCm39) missense probably benign 0.05
R7555:Per3 UTSW 4 151,102,515 (GRCm39) nonsense probably null
R7771:Per3 UTSW 4 151,125,902 (GRCm39) missense probably damaging 1.00
R7771:Per3 UTSW 4 151,110,657 (GRCm39) missense probably damaging 1.00
R8071:Per3 UTSW 4 151,113,270 (GRCm39) missense probably damaging 1.00
R8079:Per3 UTSW 4 151,127,135 (GRCm39) missense possibly damaging 0.81
R8099:Per3 UTSW 4 151,097,014 (GRCm39) missense possibly damaging 0.92
R9153:Per3 UTSW 4 151,111,796 (GRCm39) missense probably benign 0.18
R9449:Per3 UTSW 4 151,094,945 (GRCm39) missense probably benign 0.02
R9566:Per3 UTSW 4 151,113,335 (GRCm39) missense
R9585:Per3 UTSW 4 151,097,138 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TACATCAGCTTTAGACTTGCTTGTC -3'
(R):5'- AATGTCCCCTACCTGGAAGAG -3'

Sequencing Primer
(F):5'- GCTTGTCTTGGCTACAAATAAAGC -3'
(R):5'- TCCCCTACCTGGAAGAGAAAGG -3'
Posted On 2018-11-06