Mutagenetix > Incidental Mutation

Incidental Mutation 'R6915:Akap9'

539272

Institutional Source

Beutler Lab

Gene Symbol

Akap9

Ensembl Gene

ENSMUSG00000040407

Gene Name

A kinase (PRKA) anchor protein (yotiao) 9

Synonyms

AKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.482) question?

Stock #

R6915 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3928054-4081310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3960551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 436 (M436K)

Ref Sequence

ENSEMBL: ENSMUSP00000117209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044492
AA Change: M418K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: M418K

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
Blast:HPT	126	197	6e-21	BLAST
low complexity region	237	249	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
coiled coil region	404	593	N/A	INTRINSIC
coiled coil region	622	756	N/A	INTRINSIC
coiled coil region	777	843	N/A	INTRINSIC
coiled coil region	888	958	N/A	INTRINSIC
low complexity region	982	997	N/A	INTRINSIC
coiled coil region	1037	1065	N/A	INTRINSIC
low complexity region	1233	1246	N/A	INTRINSIC
internal_repeat_2	1247	1312	7.75e-5	PROSPERO
internal_repeat_1	1377	1485	2.63e-5	PROSPERO
coiled coil region	1522	1589	N/A	INTRINSIC
coiled coil region	1789	2107	N/A	INTRINSIC
coiled coil region	2132	2318	N/A	INTRINSIC
internal_repeat_1	2322	2445	2.63e-5	PROSPERO
coiled coil region	2455	2494	N/A	INTRINSIC
low complexity region	2587	2598	N/A	INTRINSIC
low complexity region	2627	2640	N/A	INTRINSIC
internal_repeat_2	2934	2997	7.75e-5	PROSPERO
low complexity region	3000	3016	N/A	INTRINSIC
coiled coil region	3109	3307	N/A	INTRINSIC
coiled coil region	3455	3493	N/A	INTRINSIC
coiled coil region	3521	3556	N/A	INTRINSIC
Pfam:PACT_coil_coil	3576	3657	1.2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143365
AA Change: M436K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407
AA Change: M436K

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
low complexity region	33	44	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Blast:HPT	144	215	9e-22	BLAST
low complexity region	255	267	N/A	INTRINSIC
low complexity region	315	333	N/A	INTRINSIC
coiled coil region	422	571	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dnm3	T	C	1: 162,318,397		probably null	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lair1	A	T	7: 4,055,953	V12E	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pfas	C	T	11: 68,992,181	R759Q	probably benign	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tinag	T	A	9: 77,001,615	Y348F	probably damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Akap9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Akap9	APN	5	4046639	missense	probably damaging	0.97
IGL00642:Akap9	APN	5	3960842	missense	probably damaging	0.99
IGL00786:Akap9	APN	5	4070522	missense	probably damaging	1.00
IGL00788:Akap9	APN	5	4060480	missense	probably damaging	1.00
IGL00969:Akap9	APN	5	4001550	missense	probably benign
IGL01014:Akap9	APN	5	3968683	missense	probably benign	0.41
IGL01302:Akap9	APN	5	3970711	missense	probably benign	0.27
IGL01610:Akap9	APN	5	4032839	missense	possibly damaging	0.95
IGL01620:Akap9	APN	5	3960218	missense	probably benign	0.11
IGL01862:Akap9	APN	5	3951705	missense	probably damaging	0.99
IGL01862:Akap9	APN	5	4065856	missense	probably damaging	0.99
IGL02151:Akap9	APN	5	4032728	nonsense	probably null
IGL02635:Akap9	APN	5	4070500	missense	possibly damaging	0.59
IGL02858:Akap9	APN	5	4069130	missense	possibly damaging	0.88
IGL02967:Akap9	APN	5	3976164	missense	probably benign	0.07
IGL03064:Akap9	APN	5	3968755	missense	probably damaging	1.00
IGL03289:Akap9	APN	5	4077261	missense	probably damaging	1.00
Andy	UTSW	5	3961764	nonsense	probably null
blimey	UTSW	5	4070397	nonsense	probably null
hoarder	UTSW	5	4069089	missense	probably benign	0.00
marinarum	UTSW	5	4013875	nonsense	probably null
miser	UTSW	5	4046064	missense	probably benign	0.13
naviculus	UTSW	5	3960865	missense	probably damaging	0.98
thrifty	UTSW	5	3976209	missense	probably damaging	0.99
wee_one	UTSW	5	4043925	missense	probably damaging	1.00
FR4449:Akap9	UTSW	5	3981214	unclassified	probably benign
PIT1430001:Akap9	UTSW	5	4029849	missense	probably damaging	1.00
PIT4366001:Akap9	UTSW	5	4046221	missense	probably benign	0.24
R0088:Akap9	UTSW	5	3961946	missense	probably benign	0.22
R0309:Akap9	UTSW	5	4069038	missense	probably benign	0.01
R0387:Akap9	UTSW	5	3951678	splice site	probably benign
R0440:Akap9	UTSW	5	4064569	missense	probably damaging	0.99
R0441:Akap9	UTSW	5	3961714	missense	probably benign	0.15
R0491:Akap9	UTSW	5	3972851	unclassified	probably benign
R0501:Akap9	UTSW	5	3970685	missense	probably damaging	1.00
R0507:Akap9	UTSW	5	4069043	missense	probably benign	0.41
R0544:Akap9	UTSW	5	4069185	missense	probably benign	0.22
R0581:Akap9	UTSW	5	4050620	missense	probably benign	0.03
R0611:Akap9	UTSW	5	3954870	missense	probably benign	0.00
R0620:Akap9	UTSW	5	4064136	missense	probably damaging	0.98
R0639:Akap9	UTSW	5	4060318	missense	probably damaging	1.00
R0932:Akap9	UTSW	5	4046492	missense	possibly damaging	0.77
R0944:Akap9	UTSW	5	4064742	splice site	probably null
R1101:Akap9	UTSW	5	4046205	missense	probably benign	0.00
R1159:Akap9	UTSW	5	3960865	missense	probably damaging	0.98
R1170:Akap9	UTSW	5	4055671	missense	probably benign
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1185:Akap9	UTSW	5	3948783	missense	probably benign	0.13
R1453:Akap9	UTSW	5	3975614	splice site	probably null
R1551:Akap9	UTSW	5	4069174	missense	probably benign	0.02
R1608:Akap9	UTSW	5	3961783	missense	probably damaging	1.00
R1652:Akap9	UTSW	5	4077210	missense	probably damaging	1.00
R1659:Akap9	UTSW	5	4064633	missense	probably damaging	1.00
R1713:Akap9	UTSW	5	4039345	critical splice donor site	probably null
R1719:Akap9	UTSW	5	3957645	nonsense	probably null
R1720:Akap9	UTSW	5	3972791	missense	possibly damaging	0.63
R1757:Akap9	UTSW	5	4001667	missense	probably benign	0.41
R1872:Akap9	UTSW	5	4001406	missense	probably damaging	1.00
R1876:Akap9	UTSW	5	3961809	missense	probably benign	0.28
R1881:Akap9	UTSW	5	4050173	missense	probably benign
R1950:Akap9	UTSW	5	3960677	missense	probably damaging	1.00
R1980:Akap9	UTSW	5	3972771	missense	probably damaging	0.99
R1993:Akap9	UTSW	5	4038520	splice site	probably null
R2008:Akap9	UTSW	5	3960131	missense	possibly damaging	0.47
R2020:Akap9	UTSW	5	3961967	missense	probably damaging	1.00
R2051:Akap9	UTSW	5	3975685	nonsense	probably null
R2061:Akap9	UTSW	5	3961010	missense	probably damaging	1.00
R2109:Akap9	UTSW	5	4044847	missense	possibly damaging	0.47
R2135:Akap9	UTSW	5	4064509	missense	probably damaging	1.00
R2225:Akap9	UTSW	5	4077271	missense	probably damaging	0.96
R2232:Akap9	UTSW	5	4046603	missense	probably damaging	1.00
R2424:Akap9	UTSW	5	4065279	missense	probably damaging	0.97
R2483:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R2879:Akap9	UTSW	5	3976353	intron	probably benign
R3622:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3623:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3624:Akap9	UTSW	5	3976235	missense	possibly damaging	0.65
R3722:Akap9	UTSW	5	4070351	missense	probably damaging	1.00
R3806:Akap9	UTSW	5	3954410	missense	probably benign	0.00
R3919:Akap9	UTSW	5	3961764	nonsense	probably null
R4023:Akap9	UTSW	5	3992077	missense	possibly damaging	0.66
R4093:Akap9	UTSW	5	4043996	missense	probably damaging	0.99
R4434:Akap9	UTSW	5	4032708	missense	probably damaging	0.99
R4529:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4530:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4532:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4533:Akap9	UTSW	5	4043948	missense	probably damaging	1.00
R4585:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4586:Akap9	UTSW	5	3976151	missense	probably benign	0.00
R4655:Akap9	UTSW	5	4046403	missense	probably benign	0.14
R4676:Akap9	UTSW	5	4032774	missense	probably damaging	1.00
R4676:Akap9	UTSW	5	4064515	nonsense	probably null
R4724:Akap9	UTSW	5	4055339	missense	probably benign
R4731:Akap9	UTSW	5	3962266	missense	possibly damaging	0.54
R4732:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4733:Akap9	UTSW	5	4013901	missense	probably damaging	0.98
R4743:Akap9	UTSW	5	3961013	missense	probably damaging	1.00
R4749:Akap9	UTSW	5	3968737	missense	probably benign	0.41
R4756:Akap9	UTSW	5	4001418	missense	probably damaging	0.99
R4757:Akap9	UTSW	5	4008382	missense	probably damaging	1.00
R4860:Akap9	UTSW	5	4034916	intron	probably benign
R4937:Akap9	UTSW	5	4050145	splice site	probably null
R4960:Akap9	UTSW	5	3957664	missense	probably benign	0.15
R4974:Akap9	UTSW	5	3961466	missense	possibly damaging	0.81
R5101:Akap9	UTSW	5	4001748	missense	probably damaging	0.96
R5160:Akap9	UTSW	5	4030007	missense	probably damaging	1.00
R5200:Akap9	UTSW	5	3960734	missense	probably benign	0.00
R5245:Akap9	UTSW	5	3976209	missense	probably damaging	0.99
R5293:Akap9	UTSW	5	3948687	missense	probably damaging	0.99
R5408:Akap9	UTSW	5	4058458	missense	possibly damaging	0.84
R5507:Akap9	UTSW	5	3968683	missense	probably benign	0.41
R5517:Akap9	UTSW	5	4001665	missense	possibly damaging	0.76
R5579:Akap9	UTSW	5	4064714	missense	possibly damaging	0.93
R5619:Akap9	UTSW	5	3954760	intron	probably benign
R5645:Akap9	UTSW	5	4050590	missense	probably benign	0.09
R5669:Akap9	UTSW	5	4050540	nonsense	probably null
R5686:Akap9	UTSW	5	3971926	missense	probably benign	0.00
R5697:Akap9	UTSW	5	3960170	missense	possibly damaging	0.92
R5821:Akap9	UTSW	5	4046064	missense	probably benign	0.13
R5875:Akap9	UTSW	5	4077285	missense	probably benign	0.01
R5897:Akap9	UTSW	5	4077904	missense	probably benign	0.23
R5999:Akap9	UTSW	5	4043925	missense	probably damaging	1.00
R6025:Akap9	UTSW	5	4032801	missense	probably damaging	1.00
R6078:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6138:Akap9	UTSW	5	4067924	critical splice donor site	probably null
R6225:Akap9	UTSW	5	3962105	missense	probably damaging	1.00
R6243:Akap9	UTSW	5	4065000	splice site	probably null
R6326:Akap9	UTSW	5	3962061	missense	probably damaging	1.00
R6564:Akap9	UTSW	5	4028491	missense	probably damaging	0.98
R6617:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6625:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R6632:Akap9	UTSW	5	4013842	splice site	probably null
R6677:Akap9	UTSW	5	4029869	missense	probably benign	0.21
R6717:Akap9	UTSW	5	4064086	missense	probably damaging	1.00
R6893:Akap9	UTSW	5	3961709	missense	probably benign	0.32
R6938:Akap9	UTSW	5	4046628	missense	possibly damaging	0.91
R6972:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6973:Akap9	UTSW	5	4046699	missense	possibly damaging	0.62
R6993:Akap9	UTSW	5	4065866	missense	possibly damaging	0.65
R7032:Akap9	UTSW	5	3954896	missense	probably benign
R7164:Akap9	UTSW	5	4060364	missense	probably damaging	0.96
R7170:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7192:Akap9	UTSW	5	4005723	splice site	probably null
R7284:Akap9	UTSW	5	3956246	missense	probably damaging	1.00
R7299:Akap9	UTSW	5	4032696	missense	probably damaging	1.00
R7313:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7326:Akap9	UTSW	5	4045930	missense	possibly damaging	0.47
R7343:Akap9	UTSW	5	4046364	missense	probably damaging	0.99
R7455:Akap9	UTSW	5	3972792	missense	probably benign	0.03
R7482:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7489:Akap9	UTSW	5	4004933	missense	probably damaging	1.00
R7525:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7528:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7576:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7577:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7578:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7610:Akap9	UTSW	5	3957677	missense	possibly damaging	0.95
R7658:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R7754:Akap9	UTSW	5	4046736	missense	probably benign	0.03
R7818:Akap9	UTSW	5	4013875	nonsense	probably null
R7979:Akap9	UTSW	5	4050381	missense	probably benign
R7991:Akap9	UTSW	5	4064949	splice site	probably null
R8036:Akap9	UTSW	5	4070397	nonsense	probably null
R8054:Akap9	UTSW	5	4038707	critical splice donor site	probably null
R8116:Akap9	UTSW	5	4061183	missense	probably benign	0.04
R8150:Akap9	UTSW	5	3961982	missense	probably damaging	1.00
R8234:Akap9	UTSW	5	4044845	missense	probably benign	0.18
R8348:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8365:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8366:Akap9	UTSW	5	3968745	missense	probably benign	0.04
R8448:Akap9	UTSW	5	3948897	critical splice donor site	probably null
R8466:Akap9	UTSW	5	4038659	missense	probably damaging	1.00
R8772:Akap9	UTSW	5	4046255	missense	probably damaging	1.00
R8881:Akap9	UTSW	5	3961279	missense
R8937:Akap9	UTSW	5	4044048	missense	possibly damaging	0.78
R8956:Akap9	UTSW	5	3948805	missense	possibly damaging	0.79
R9000:Akap9	UTSW	5	4055650	missense	probably benign
R9049:Akap9	UTSW	5	4064597	missense
R9074:Akap9	UTSW	5	4077959	missense	probably benign	0.40
R9124:Akap9	UTSW	5	4061284	missense	probably damaging	0.99
R9129:Akap9	UTSW	5	4069089	missense	probably benign	0.00
R9371:Akap9	UTSW	5	3961852	missense	possibly damaging	0.83
R9424:Akap9	UTSW	5	3962223	nonsense	probably null
R9424:Akap9	UTSW	5	3962224	nonsense	probably null
R9509:Akap9	UTSW	5	4046349	missense	probably benign
R9515:Akap9	UTSW	5	4055709	missense	probably damaging	1.00
R9567:Akap9	UTSW	5	4077311	missense	possibly damaging	0.89
R9587:Akap9	UTSW	5	4069149	missense	probably damaging	1.00
R9619:Akap9	UTSW	5	4044833	missense	probably damaging	1.00
R9635:Akap9	UTSW	5	4050545	missense	probably benign	0.20
R9680:Akap9	UTSW	5	3961587	missense	probably benign	0.03
R9691:Akap9	UTSW	5	3960491	missense	probably damaging	1.00
R9726:Akap9	UTSW	5	4003757	missense	probably benign	0.39
U15987:Akap9	UTSW	5	4067924	critical splice donor site	probably null
X0026:Akap9	UTSW	5	4014039	missense	probably damaging	1.00
X0057:Akap9	UTSW	5	3975598	critical splice acceptor site	probably null
Z1176:Akap9	UTSW	5	3962251	missense	probably damaging	0.96
Z1177:Akap9	UTSW	5	4046189	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAACGAGCGGAAGTGTTC -3'
(R):5'- GACTTTTCTCCCAGAACTACGC -3'

Sequencing Primer
(F):5'- CTAATGAGGACAGTTGAAGAACTCC -3'
(R):5'- ACGCCAAGCTCTCCCTTGAG -3'

Posted On

2018-11-06