Incidental Mutation 'R6915:Cldn3'
ID 539275
Institutional Source Beutler Lab
Gene Symbol Cldn3
Ensembl Gene ENSMUSG00000070473
Gene Name claudin 3
Synonyms Cpetr2
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 135015068-135016326 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135015426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 43 (Q43R)
Ref Sequence ENSEMBL: ENSMUSP00000091799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094245]
AlphaFold Q9Z0G9
Predicted Effect probably damaging
Transcript: ENSMUST00000094245
AA Change: Q43R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091799
Gene: ENSMUSG00000070473
AA Change: Q43R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 180 1.8e-35 PFAM
Pfam:Claudin_2 10 182 4.6e-12 PFAM
low complexity region 203 211 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a low-affinity receptor for clostridium perfringens enterotoxin (CPE) produced by the bacterium Clostridium perfringens, and the interaction with CPE results in increased membrane permeability by forming small pores in plasma membrane. This protein is highly overexpressed in uterine carcinosarcoma. This protein is also predominantly present in brain endothelial cells, where it plays a specific role in the establishment and maintenance of blood brain barrier tight junction morphology. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a null allele are fertile with mutant males exhibiting normal spermatogenesis and fully functional Sertoli cell tight junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Cldn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6235:Cldn3 UTSW 5 135,015,573 (GRCm39) missense possibly damaging 0.61
R7326:Cldn3 UTSW 5 135,015,837 (GRCm39) missense probably damaging 1.00
R9269:Cldn3 UTSW 5 135,015,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTTGATTCCCAGGTCCAG -3'
(R):5'- TGTACGCAGTTGGTACACTG -3'

Sequencing Primer
(F):5'- CGCGATCCCTGGTCTCC -3'
(R):5'- AGTTGGTACACTGGGCGC -3'
Posted On 2018-11-06