Incidental Mutation 'R6915:Exoc4'
ID 539277
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Name exocyst complex component 4
Synonyms Sec8, Sec8l1
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 33226025-33950914 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33898388 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 869 (K869R)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
AlphaFold O35382
Predicted Effect possibly damaging
Transcript: ENSMUST00000052266
AA Change: K869R

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: K869R

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33,895,334 (GRCm39) critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33,273,723 (GRCm39) missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33,948,859 (GRCm39) missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33,282,335 (GRCm39) splice site probably benign
IGL01559:Exoc4 APN 6 33,243,011 (GRCm39) missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33,734,894 (GRCm39) splice site probably benign
IGL01926:Exoc4 APN 6 33,839,077 (GRCm39) missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33,556,961 (GRCm39) missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33,887,519 (GRCm39) missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33,226,175 (GRCm39) critical splice donor site probably null
IGL02668:Exoc4 APN 6 33,898,467 (GRCm39) missense probably benign 0.00
slacker UTSW 6 33,735,033 (GRCm39) missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33,273,857 (GRCm39) splice site probably null
R0134:Exoc4 UTSW 6 33,948,881 (GRCm39) missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33,839,022 (GRCm39) missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33,839,022 (GRCm39) missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33,948,998 (GRCm39) missense probably benign 0.09
R1033:Exoc4 UTSW 6 33,242,922 (GRCm39) missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33,895,359 (GRCm39) missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33,418,951 (GRCm39) missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33,734,985 (GRCm39) missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33,243,026 (GRCm39) missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33,887,522 (GRCm39) missense probably benign 0.06
R2114:Exoc4 UTSW 6 33,324,760 (GRCm39) missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33,324,760 (GRCm39) missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33,324,760 (GRCm39) missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33,887,473 (GRCm39) missense probably benign
R2133:Exoc4 UTSW 6 33,735,093 (GRCm39) missense probably benign 0.00
R2308:Exoc4 UTSW 6 33,895,503 (GRCm39) missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33,242,910 (GRCm39) missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33,452,932 (GRCm39) missense probably benign
R3885:Exoc4 UTSW 6 33,243,066 (GRCm39) critical splice donor site probably null
R4378:Exoc4 UTSW 6 33,792,622 (GRCm39) missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33,254,179 (GRCm39) missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33,254,179 (GRCm39) missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33,254,179 (GRCm39) missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33,415,340 (GRCm39) missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33,839,139 (GRCm39) missense probably benign 0.00
R4771:Exoc4 UTSW 6 33,418,884 (GRCm39) critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33,895,343 (GRCm39) missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33,887,452 (GRCm39) missense probably benign
R5358:Exoc4 UTSW 6 33,242,934 (GRCm39) missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33,895,367 (GRCm39) missense probably benign
R6014:Exoc4 UTSW 6 33,452,932 (GRCm39) missense probably benign
R6132:Exoc4 UTSW 6 33,735,033 (GRCm39) missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33,309,218 (GRCm39) missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33,792,688 (GRCm39) missense probably damaging 1.00
R6973:Exoc4 UTSW 6 33,556,965 (GRCm39) missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33,898,423 (GRCm39) missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33,948,934 (GRCm39) missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33,415,408 (GRCm39) missense probably benign 0.07
R7547:Exoc4 UTSW 6 33,816,056 (GRCm39) missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33,735,001 (GRCm39) missense probably benign 0.00
R8024:Exoc4 UTSW 6 33,324,866 (GRCm39) missense probably damaging 1.00
R8053:Exoc4 UTSW 6 33,309,191 (GRCm39) missense probably benign 0.45
R8118:Exoc4 UTSW 6 33,948,853 (GRCm39) missense probably damaging 1.00
R8154:Exoc4 UTSW 6 33,887,473 (GRCm39) missense probably benign
R8485:Exoc4 UTSW 6 33,898,436 (GRCm39) missense probably damaging 1.00
R9226:Exoc4 UTSW 6 33,895,359 (GRCm39) missense possibly damaging 0.87
R9402:Exoc4 UTSW 6 33,453,078 (GRCm39) makesense probably null
R9612:Exoc4 UTSW 6 33,226,161 (GRCm39) missense probably benign 0.19
R9711:Exoc4 UTSW 6 33,452,991 (GRCm39) missense unknown
X0066:Exoc4 UTSW 6 33,792,625 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTTGCCAGATTAGCTATTGC -3'
(R):5'- TGACTGAACTATTTCTCCAGACATC -3'

Sequencing Primer
(F):5'- GCCAGATTAGCTATTGCAAATGG -3'
(R):5'- GAACTATTTCTCCAGACATCTTTCTC -3'
Posted On 2018-11-06