Incidental Mutation 'R6915:Exoc4'
ID539277
Institutional Source Beutler Lab
Gene Symbol Exoc4
Ensembl Gene ENSMUSG00000029763
Gene Nameexocyst complex component 4
SynonymsSec8l1, Sec8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location33249085-33973979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33921453 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 869 (K869R)
Ref Sequence ENSEMBL: ENSMUSP00000051965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052266
AA Change: K869R

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051965
Gene: ENSMUSG00000029763
AA Change: K869R

DomainStartEndE-ValueType
Pfam:Sec8_exocyst 28 144 2.4e-21 PFAM
low complexity region 338 346 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic abnormatlities. Gastrulation is not completed and mesoderm formation is abnormal. Death occurs before E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Exoc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Exoc4 APN 6 33918399 critical splice acceptor site probably null
IGL00433:Exoc4 APN 6 33296788 missense probably damaging 1.00
IGL00833:Exoc4 APN 6 33971924 missense probably damaging 1.00
IGL01339:Exoc4 APN 6 33305400 splice site probably benign
IGL01559:Exoc4 APN 6 33266076 missense probably damaging 0.96
IGL01812:Exoc4 APN 6 33757959 splice site probably benign
IGL01926:Exoc4 APN 6 33862142 missense probably damaging 1.00
IGL02270:Exoc4 APN 6 33580026 missense possibly damaging 0.61
IGL02316:Exoc4 APN 6 33910584 missense probably damaging 0.98
IGL02332:Exoc4 APN 6 33249240 critical splice donor site probably null
IGL02668:Exoc4 APN 6 33921532 missense probably benign 0.00
slacker UTSW 6 33758098 missense probably damaging 1.00
R0049:Exoc4 UTSW 6 33296922 splice site probably null
R0134:Exoc4 UTSW 6 33971946 missense possibly damaging 0.56
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0234:Exoc4 UTSW 6 33862087 missense possibly damaging 0.89
R0538:Exoc4 UTSW 6 33972063 missense probably benign 0.09
R1033:Exoc4 UTSW 6 33265987 missense probably damaging 1.00
R1067:Exoc4 UTSW 6 33918424 missense possibly damaging 0.87
R1109:Exoc4 UTSW 6 33442016 missense probably damaging 1.00
R1768:Exoc4 UTSW 6 33758050 missense probably damaging 1.00
R2013:Exoc4 UTSW 6 33266091 missense probably damaging 0.96
R2078:Exoc4 UTSW 6 33910587 missense probably benign 0.06
R2114:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2115:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2117:Exoc4 UTSW 6 33347825 missense possibly damaging 0.74
R2133:Exoc4 UTSW 6 33758158 missense probably benign 0.00
R2133:Exoc4 UTSW 6 33910538 missense probably benign
R2308:Exoc4 UTSW 6 33918568 missense probably damaging 1.00
R3412:Exoc4 UTSW 6 33265975 missense probably damaging 1.00
R3794:Exoc4 UTSW 6 33475997 missense probably benign
R3885:Exoc4 UTSW 6 33266131 critical splice donor site probably null
R4378:Exoc4 UTSW 6 33815687 missense probably damaging 1.00
R4534:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4535:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4536:Exoc4 UTSW 6 33277244 missense probably damaging 1.00
R4611:Exoc4 UTSW 6 33438405 missense possibly damaging 0.77
R4617:Exoc4 UTSW 6 33862204 missense probably benign 0.00
R4771:Exoc4 UTSW 6 33441949 critical splice acceptor site probably null
R4851:Exoc4 UTSW 6 33918408 missense probably damaging 0.96
R4921:Exoc4 UTSW 6 33910517 missense probably benign
R5358:Exoc4 UTSW 6 33265999 missense probably damaging 1.00
R5767:Exoc4 UTSW 6 33918432 missense probably benign
R6014:Exoc4 UTSW 6 33475997 missense probably benign
R6132:Exoc4 UTSW 6 33758098 missense probably damaging 1.00
R6164:Exoc4 UTSW 6 33332283 missense probably damaging 0.99
R6583:Exoc4 UTSW 6 33815753 missense probably damaging 1.00
R6973:Exoc4 UTSW 6 33580030 missense probably damaging 1.00
R7112:Exoc4 UTSW 6 33921488 missense probably damaging 1.00
R7129:Exoc4 UTSW 6 33971999 missense probably damaging 1.00
R7133:Exoc4 UTSW 6 33438473 missense probably benign 0.07
R7547:Exoc4 UTSW 6 33839121 missense possibly damaging 0.95
R7885:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R7968:Exoc4 UTSW 6 33758066 missense probably benign 0.00
R8024:Exoc4 UTSW 6 33347931 missense not run
R8053:Exoc4 UTSW 6 33332256 missense not run
X0066:Exoc4 UTSW 6 33815690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTTGCCAGATTAGCTATTGC -3'
(R):5'- TGACTGAACTATTTCTCCAGACATC -3'

Sequencing Primer
(F):5'- GCCAGATTAGCTATTGCAAATGG -3'
(R):5'- GAACTATTTCTCCAGACATCTTTCTC -3'
Posted On2018-11-06