Mutagenetix > Incidental Mutation

Incidental Mutation 'R6915:Lair1'

539279

Institutional Source

Beutler Lab

Gene Symbol

Lair1

Ensembl Gene

ENSMUSG00000055541

Gene Name

leukocyte-associated Ig-like receptor 1

Synonyms

mLair-1, Lair-1, 5133400O11Rik, D7Bwg0421e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6915 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4003402-4063204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 4055953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 12 (V12E)

Ref Sequence

ENSEMBL: ENSMUSP00000145940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]

AlphaFold

Q8BG84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068865
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086400
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	5e-79	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	9e-27	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086401
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	134	1e-78	PDB
SCOP:d1nkr_2	24	118	2e-9	SMART
Blast:IG	38	119	2e-26	BLAST
transmembrane domain	143	165	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108600
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
PDB:4ETY\|D	22	133	8e-79	PDB
SCOP:d1nkr_2	24	118	1e-9	SMART
Blast:IG	38	119	6e-27	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131126
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136616
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000149395
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541
AA Change: V12E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205296
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.7231

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Akap9	T	A	5: 3,960,551	M436K	probably benign	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dnm3	T	C	1: 162,318,397		probably null	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pfas	C	T	11: 68,992,181	R759Q	probably benign	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tinag	T	A	9: 77,001,615	Y348F	probably damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Lair1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lair1	APN	7	4028731	missense	probably benign	0.01
IGL01475:Lair1	APN	7	4009684	utr 3 prime	probably benign
IGL02696:Lair1	APN	7	4010849	intron	probably benign
IGL02749:Lair1	APN	7	4028901	missense	possibly damaging	0.50
R0396:Lair1	UTSW	7	4010786	missense	probably damaging	1.00
R0703:Lair1	UTSW	7	4010760	missense	probably null	0.99
R1053:Lair1	UTSW	7	4028785	missense	probably damaging	1.00
R1332:Lair1	UTSW	7	4010596	missense	possibly damaging	0.77
R1717:Lair1	UTSW	7	4010789	missense	probably damaging	1.00
R2022:Lair1	UTSW	7	4063064	splice site	probably null
R2509:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R3721:Lair1	UTSW	7	4010783	missense	probably damaging	1.00
R4021:Lair1	UTSW	7	4055916	critical splice donor site	probably null
R4784:Lair1	UTSW	7	4009732	missense	probably benign	0.15
R4873:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R4875:Lair1	UTSW	7	4029034	missense	probably benign	0.05
R4940:Lair1	UTSW	7	4028949	missense	probably benign	0.00
R5125:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5178:Lair1	UTSW	7	4010489	missense	possibly damaging	0.92
R5888:Lair1	UTSW	7	4010845	missense	probably damaging	0.96
R5965:Lair1	UTSW	7	4029024	missense	possibly damaging	0.46
R6119:Lair1	UTSW	7	4028896	missense	probably benign	0.43
R6265:Lair1	UTSW	7	4055827	intron	probably benign
R6305:Lair1	UTSW	7	4010728	critical splice donor site	probably null
R7964:Lair1	UTSW	7	4010804	missense	probably benign	0.22
R7991:Lair1	UTSW	7	4028970	missense	probably damaging	1.00
R9414:Lair1	UTSW	7	4010820	missense	probably benign	0.09
R9787:Lair1	UTSW	7	4010795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCAAAACAGCATGCTTCATTTC -3'
(R):5'- TCTTACAAAACAAGACAGAGGATTC -3'

Sequencing Primer
(F):5'- CAAAACAGCATGCTTCATTTCATAAG -3'
(R):5'- CTACTCTGACATTAATGTGGAGGAGC -3'

Posted On

2018-11-06