Incidental Mutation 'R6915:Lair1'
ID 539279
Institutional Source Beutler Lab
Gene Symbol Lair1
Ensembl Gene ENSMUSG00000055541
Gene Name leukocyte-associated Ig-like receptor 1
Synonyms 5133400O11Rik, Lair-1, D7Bwg0421e, mLair-1
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 4006401-4066203 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4058952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 12 (V12E)
Ref Sequence ENSEMBL: ENSMUSP00000145940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068865] [ENSMUST00000086400] [ENSMUST00000086401] [ENSMUST00000108600] [ENSMUST00000131126] [ENSMUST00000136616] [ENSMUST00000149395] [ENSMUST00000205296]
AlphaFold Q8BG84
Predicted Effect possibly damaging
Transcript: ENSMUST00000068865
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070712
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086400
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083588
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 5e-79 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 9e-27 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086401
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083589
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 134 1e-78 PDB
SCOP:d1nkr_2 24 118 2e-9 SMART
Blast:IG 38 119 2e-26 BLAST
transmembrane domain 143 165 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108600
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104241
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4ETY|D 22 133 8e-79 PDB
SCOP:d1nkr_2 24 118 1e-9 SMART
Blast:IG 38 119 6e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131126
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121738
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136616
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122037
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149395
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116800
Gene: ENSMUSG00000055541
AA Change: V12E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205296
AA Change: V12E

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.7231 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. The encoded protein has been identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and of normal longevity but show increased numbers of splenic B, regulatory T, and dendritic cells, and eosinophilia at a young age. Aging homozygotes display a higher frequency of activated and effector/memory T cells and a decreased IgG1 level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Lair1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lair1 APN 7 4,031,730 (GRCm39) missense probably benign 0.01
IGL01475:Lair1 APN 7 4,012,683 (GRCm39) utr 3 prime probably benign
IGL02696:Lair1 APN 7 4,013,848 (GRCm39) intron probably benign
IGL02749:Lair1 APN 7 4,031,900 (GRCm39) missense possibly damaging 0.50
R0396:Lair1 UTSW 7 4,013,785 (GRCm39) missense probably damaging 1.00
R0703:Lair1 UTSW 7 4,013,759 (GRCm39) missense probably null 0.99
R1053:Lair1 UTSW 7 4,031,784 (GRCm39) missense probably damaging 1.00
R1332:Lair1 UTSW 7 4,013,595 (GRCm39) missense possibly damaging 0.77
R1717:Lair1 UTSW 7 4,013,788 (GRCm39) missense probably damaging 1.00
R2022:Lair1 UTSW 7 4,066,063 (GRCm39) splice site probably null
R2509:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R3721:Lair1 UTSW 7 4,013,782 (GRCm39) missense probably damaging 1.00
R4021:Lair1 UTSW 7 4,058,915 (GRCm39) critical splice donor site probably null
R4784:Lair1 UTSW 7 4,012,731 (GRCm39) missense probably benign 0.15
R4873:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4875:Lair1 UTSW 7 4,032,033 (GRCm39) missense probably benign 0.05
R4940:Lair1 UTSW 7 4,031,948 (GRCm39) missense probably benign 0.00
R5125:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5178:Lair1 UTSW 7 4,013,488 (GRCm39) missense possibly damaging 0.92
R5888:Lair1 UTSW 7 4,013,844 (GRCm39) missense probably damaging 0.96
R5965:Lair1 UTSW 7 4,032,023 (GRCm39) missense possibly damaging 0.46
R6119:Lair1 UTSW 7 4,031,895 (GRCm39) missense probably benign 0.43
R6265:Lair1 UTSW 7 4,058,826 (GRCm39) intron probably benign
R6305:Lair1 UTSW 7 4,013,727 (GRCm39) critical splice donor site probably null
R7964:Lair1 UTSW 7 4,013,803 (GRCm39) missense probably benign 0.22
R7991:Lair1 UTSW 7 4,031,969 (GRCm39) missense probably damaging 1.00
R9414:Lair1 UTSW 7 4,013,819 (GRCm39) missense probably benign 0.09
R9787:Lair1 UTSW 7 4,013,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCAAAACAGCATGCTTCATTTC -3'
(R):5'- TCTTACAAAACAAGACAGAGGATTC -3'

Sequencing Primer
(F):5'- CAAAACAGCATGCTTCATTTCATAAG -3'
(R):5'- CTACTCTGACATTAATGTGGAGGAGC -3'
Posted On 2018-11-06