Incidental Mutation 'R6915:Ppp1r3b'
ID539280
Institutional Source Beutler Lab
Gene Symbol Ppp1r3b
Ensembl Gene ENSMUSG00000046794
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3B
SynonymsGL
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35375739-35388139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35384667 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000147633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070481] [ENSMUST00000210337] [ENSMUST00000211648]
Predicted Effect probably damaging
Transcript: ENSMUST00000070481
AA Change: Y220C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065679
Gene: ENSMUSG00000046794
AA Change: Y220C

DomainStartEndE-ValueType
Pfam:CBM_21 126 232 1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210337
AA Change: Y220C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000211648
AA Change: Y220C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of the serine/theonine phosphatase, protein phosphatase-1. The encoded protein is expressed in liver and skeletal muscle tissue and may be involved in regulating glycogen synthesis in these tissues. This gene may be a involved in type 2 diabetes and maturity-onset diabetes of the young. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-in point mutation exhibit improved glucose tolerance and increased weight loss and serum glucose level in response to a 36 hour fast. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Ppp1r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ppp1r3b APN 8 35384322 missense probably benign 0.16
IGL01417:Ppp1r3b APN 8 35384412 missense probably damaging 1.00
IGL01526:Ppp1r3b APN 8 35384718 missense probably benign 0.07
IGL02286:Ppp1r3b APN 8 35384361 missense probably benign 0.01
IGL02429:Ppp1r3b APN 8 35384615 missense probably benign 0.00
IGL03371:Ppp1r3b APN 8 35384249 missense possibly damaging 0.94
R0091:Ppp1r3b UTSW 8 35384667 missense probably damaging 0.99
R0234:Ppp1r3b UTSW 8 35384501 missense probably damaging 1.00
R0234:Ppp1r3b UTSW 8 35384501 missense probably damaging 1.00
R0512:Ppp1r3b UTSW 8 35384417 missense probably damaging 1.00
R2212:Ppp1r3b UTSW 8 35384225 missense possibly damaging 0.92
R6008:Ppp1r3b UTSW 8 35384201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACATTTGACACCTGGAAAAGC -3'
(R):5'- CATCTTGATCTGAGCCACGG -3'

Sequencing Primer
(F):5'- GGAAAAGCTTCACAGATTTCCCTTG -3'
(R):5'- GTCACCTGCAGTCACTAGTAGTAG -3'
Posted On2018-11-06