Mutagenetix > Incidental Mutation

Incidental Mutation 'R6915:Tinag'

539287

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R6915 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77001615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 348 (Y348F)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000034911
AA Change: Y348F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: Y348F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Meta Mutation Damage Score

0.1224

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Akap9	T	A	5: 3,960,551	M436K	probably benign	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dnm3	T	C	1: 162,318,397		probably null	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lair1	A	T	7: 4,055,953	V12E	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pfas	C	T	11: 68,992,181	R759Q	probably benign	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGCCTTAACAATTTAAAACCTGC -3'
(R):5'- ACATTTTCGAACTATGCAGGTG -3'

Sequencing Primer
(F):5'- GACCTGAGTTTAATCTCCAGGAC -3'
(R):5'- TCGAACTATGCAGGTGAATAAATAGC -3'

Posted On

2018-11-06