Incidental Mutation 'R6915:Tinag'
ID 539287
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Name tubulointerstitial nephritis antigen
Synonyms TIN-ag
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76858975-76953076 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76908897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 348 (Y348F)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
AlphaFold Q9WUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000034911
AA Change: Y348F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: Y348F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 76,952,858 (GRCm39) missense possibly damaging 0.93
IGL01524:Tinag APN 9 76,952,820 (GRCm39) missense probably damaging 1.00
IGL01537:Tinag APN 9 76,952,885 (GRCm39) missense probably benign 0.01
IGL01832:Tinag APN 9 76,939,038 (GRCm39) missense probably benign 0.18
IGL02512:Tinag APN 9 76,939,069 (GRCm39) splice site probably benign
IGL02888:Tinag APN 9 76,938,995 (GRCm39) missense probably benign 0.24
G1citation:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R0179:Tinag UTSW 9 76,904,164 (GRCm39) splice site probably benign
R0200:Tinag UTSW 9 76,859,217 (GRCm39) missense probably damaging 1.00
R0206:Tinag UTSW 9 76,907,134 (GRCm39) missense probably damaging 1.00
R0545:Tinag UTSW 9 76,938,992 (GRCm39) missense possibly damaging 0.61
R0666:Tinag UTSW 9 76,912,969 (GRCm39) missense probably benign 0.02
R0685:Tinag UTSW 9 76,859,285 (GRCm39) missense probably damaging 1.00
R0732:Tinag UTSW 9 76,908,936 (GRCm39) missense possibly damaging 0.93
R1445:Tinag UTSW 9 76,952,798 (GRCm39) missense probably damaging 1.00
R2318:Tinag UTSW 9 76,952,693 (GRCm39) missense probably damaging 1.00
R3809:Tinag UTSW 9 76,859,187 (GRCm39) missense probably benign 0.15
R4747:Tinag UTSW 9 76,904,238 (GRCm39) missense probably benign
R4781:Tinag UTSW 9 76,904,232 (GRCm39) missense possibly damaging 0.69
R5110:Tinag UTSW 9 76,859,289 (GRCm39) missense probably damaging 1.00
R5328:Tinag UTSW 9 76,912,913 (GRCm39) nonsense probably null
R5605:Tinag UTSW 9 76,952,694 (GRCm39) missense probably damaging 1.00
R5897:Tinag UTSW 9 76,952,726 (GRCm39) missense probably damaging 1.00
R6296:Tinag UTSW 9 76,904,217 (GRCm39) missense possibly damaging 0.67
R6822:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R7285:Tinag UTSW 9 76,952,943 (GRCm39) missense probably benign
R7334:Tinag UTSW 9 76,908,931 (GRCm39) missense probably damaging 1.00
R7974:Tinag UTSW 9 76,907,131 (GRCm39) missense probably benign 0.01
R8354:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R8454:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R9029:Tinag UTSW 9 76,934,296 (GRCm39) splice site probably benign
R9072:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9073:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9508:Tinag UTSW 9 76,912,981 (GRCm39) missense probably damaging 1.00
Z1177:Tinag UTSW 9 76,952,780 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGCCTTAACAATTTAAAACCTGC -3'
(R):5'- ACATTTTCGAACTATGCAGGTG -3'

Sequencing Primer
(F):5'- GACCTGAGTTTAATCTCCAGGAC -3'
(R):5'- TCGAACTATGCAGGTGAATAAATAGC -3'
Posted On 2018-11-06