Incidental Mutation 'R6915:Arid5b'
ID 539293
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT rich interactive domain 5B (MRF1-like)
Synonyms 5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt
MMRRC Submission
Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 68092520-68278740 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 68186212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 183 (Q183*)
Ref Sequence ENSEMBL: ENSMUSP00000151227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably null
Transcript: ENSMUST00000020106
AA Change: Q183*
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947
AA Change: Q183*

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219238
AA Change: Q183*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 68128975 missense probably damaging 0.96
IGL01731:Arid5b APN 10 68097609 missense probably damaging 1.00
IGL02069:Arid5b APN 10 68097399 missense probably damaging 1.00
IGL02161:Arid5b APN 10 68096668 missense probably benign 0.00
IGL02555:Arid5b APN 10 68101904 missense probably benign 0.01
IGL02873:Arid5b APN 10 68101950 missense probably benign 0.06
IGL03119:Arid5b APN 10 68243227 missense probably damaging 1.00
IGL03271:Arid5b APN 10 68097457 missense possibly damaging 0.73
gobi UTSW 10 68118345 missense possibly damaging 0.92
3-1:Arid5b UTSW 10 68098589 missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 68098011 missense probably damaging 0.99
R0108:Arid5b UTSW 10 68278729 utr 5 prime probably benign
R0525:Arid5b UTSW 10 68097846 missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68186033 missense probably damaging 1.00
R0646:Arid5b UTSW 10 68096977 missense probably damaging 1.00
R1066:Arid5b UTSW 10 68098356 missense probably benign 0.04
R1487:Arid5b UTSW 10 68097214 nonsense probably null
R1638:Arid5b UTSW 10 68277947 missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68186067 missense probably damaging 0.99
R2031:Arid5b UTSW 10 68278688 critical splice donor site probably null
R2337:Arid5b UTSW 10 68097777 missense possibly damaging 0.63
R2996:Arid5b UTSW 10 68098462 missense probably benign 0.01
R2997:Arid5b UTSW 10 68098462 missense probably benign 0.01
R3547:Arid5b UTSW 10 68098462 missense probably benign 0.01
R4411:Arid5b UTSW 10 68096689 missense probably damaging 1.00
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R5219:Arid5b UTSW 10 68278110 missense probably benign 0.08
R5341:Arid5b UTSW 10 68278127 missense possibly damaging 0.87
R5434:Arid5b UTSW 10 68096889 missense possibly damaging 0.67
R5757:Arid5b UTSW 10 68102079 missense probably damaging 1.00
R6114:Arid5b UTSW 10 68097744 missense possibly damaging 0.89
R6313:Arid5b UTSW 10 68097582 missense possibly damaging 0.95
R6338:Arid5b UTSW 10 68098561 nonsense probably null
R6525:Arid5b UTSW 10 68097666 missense possibly damaging 0.47
R7013:Arid5b UTSW 10 68097819 missense probably damaging 1.00
R7099:Arid5b UTSW 10 68098179 missense probably damaging 1.00
R7260:Arid5b UTSW 10 68097807 missense probably damaging 1.00
R7324:Arid5b UTSW 10 68128922 missense probably benign 0.44
R7334:Arid5b UTSW 10 68243177 missense possibly damaging 0.61
R7432:Arid5b UTSW 10 68118266 missense probably damaging 1.00
R7453:Arid5b UTSW 10 68243164 missense probably benign 0.01
R7649:Arid5b UTSW 10 68118345 missense possibly damaging 0.92
R7659:Arid5b UTSW 10 68098587 missense probably benign
R7661:Arid5b UTSW 10 68098587 missense probably benign
R7662:Arid5b UTSW 10 68098587 missense probably benign
R7663:Arid5b UTSW 10 68098587 missense probably benign
R7665:Arid5b UTSW 10 68098587 missense probably benign
R7666:Arid5b UTSW 10 68098587 missense probably benign
R7759:Arid5b UTSW 10 68097802 missense probably damaging 1.00
R7779:Arid5b UTSW 10 68096776 missense probably damaging 1.00
R7788:Arid5b UTSW 10 68098587 missense probably benign
R7789:Arid5b UTSW 10 68098587 missense probably benign
R7875:Arid5b UTSW 10 68128941 missense probably benign 0.02
R8079:Arid5b UTSW 10 68098356 missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68186152 missense probably benign 0.00
R8228:Arid5b UTSW 10 68278706 missense possibly damaging 0.95
R8377:Arid5b UTSW 10 68097387 missense probably damaging 0.96
R8757:Arid5b UTSW 10 68097810 missense probably damaging 1.00
R8910:Arid5b UTSW 10 68098278 missense
R8954:Arid5b UTSW 10 68101980 missense possibly damaging 0.88
R9234:Arid5b UTSW 10 68128798 missense possibly damaging 0.82
R9272:Arid5b UTSW 10 68102052 missense probably damaging 0.99
R9430:Arid5b UTSW 10 68186257 critical splice acceptor site probably null
X0066:Arid5b UTSW 10 68118302 missense probably damaging 1.00
Z1177:Arid5b UTSW 10 68097228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGACTCATTGGGACGAGTTTC -3'
(R):5'- ACTGTGCAGAAGAAGGTGTCTC -3'

Sequencing Primer
(F):5'- CTCATTGGGACGAGTTTCAAACAG -3'
(R):5'- CAGAAGAAGGTGTCTCTATTGCC -3'
Posted On 2018-11-06