Mutagenetix > Incidental Mutation

Incidental Mutation 'R6915:Pfas'

539296

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6915 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 68992181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 759 (R759Q)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000021282
AA Change: R759Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: R759Q

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149703

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152964

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Meta Mutation Damage Score

0.0778

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	C	A	12: 88,455,620	L334I	probably damaging	Het
Akap9	T	A	5: 3,960,551	M436K	probably benign	Het
Ankmy1	A	C	1: 92,888,451	F314V	probably null	Het
Arid5b	G	A	10: 68,186,212	Q183*	probably null	Het
Atp8b4	A	T	2: 126,358,914	L778*	probably null	Het
BC024139	G	T	15: 76,120,021	N739K	probably benign	Het
Carns1	T	G	19: 4,169,913	H441P	probably benign	Het
Cfap70	T	A	14: 20,409,085	I693F	probably benign	Het
Cldn3	A	G	5: 134,986,572	Q43R	probably damaging	Het
Col7a1	C	T	9: 108,967,618	P1608L	probably benign	Het
Cr2	T	A	1: 195,171,146	Y28F	probably benign	Het
Cyp2c38	T	A	19: 39,436,068	I269F	probably damaging	Het
Dapk1	A	T	13: 60,696,442	I92F	probably damaging	Het
Dennd4a	T	A	9: 64,852,489	L292*	probably null	Het
Dhx38	T	C	8: 109,559,599	E353G	probably benign	Het
Dnm3	T	C	1: 162,318,397		probably null	Het
Dzip3	T	C	16: 48,942,125	I794V	possibly damaging	Het
Eif2b5	T	A	16: 20,502,750	V351D	possibly damaging	Het
Epg5	T	A	18: 77,979,165	V1041E	probably benign	Het
Exoc4	A	G	6: 33,921,453	K869R	possibly damaging	Het
Fat3	C	A	9: 16,377,748	V160F	probably benign	Het
Gak	A	T	5: 108,602,950	Y365N	probably benign	Het
Ghrhr	T	A	6: 55,383,119		probably null	Het
Gm21738	A	G	14: 19,415,933	M202T	probably benign	Het
Gm6583	A	T	5: 112,354,657	W394R	probably damaging	Het
Havcr2	C	T	11: 46,475,911	S177L	probably benign	Het
Hkdc1	G	C	10: 62,401,932	R353G	possibly damaging	Het
Ifi208	G	A	1: 173,682,878	G200S	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lair1	A	T	7: 4,055,953	V12E	possibly damaging	Het
Lipo3	T	C	19: 33,584,893	N26D	probably damaging	Het
Lyst	T	A	13: 13,726,044	D3168E	probably benign	Het
Map6	G	A	7: 99,268,247	A76T	probably damaging	Het
Mcoln3	A	T	3: 146,137,256		probably null	Het
Muc4	T	C	16: 32,766,938	F2718L	probably benign	Het
Nek11	C	G	9: 105,393,057		probably benign	Het
Olfr1428	A	G	19: 12,109,126	V140A	probably benign	Het
Olfr372	C	A	8: 72,057,730	L17I	probably benign	Het
Olfr964-ps1	T	C	9: 39,686,536	E136G	unknown	Het
Pcdh15	A	T	10: 74,643,809	E846V	probably benign	Het
Pcdhga8	C	T	18: 37,725,945	T18M	probably benign	Het
Per3	T	C	4: 151,043,649	M61V	possibly damaging	Het
Pitpnm1	A	G	19: 4,106,947	Y490C	possibly damaging	Het
Plcb4	A	T	2: 135,947,115	I272F	possibly damaging	Het
Ppp1r3b	A	G	8: 35,384,667	Y220C	probably damaging	Het
Prkce	G	C	17: 86,493,407	G417A	probably damaging	Het
Ptar1	A	G	19: 23,703,137	N106D	probably damaging	Het
Rbm15	C	A	3: 107,332,311	R257L	probably benign	Het
Rptor	T	G	11: 119,756,345	M254R	probably damaging	Het
Runx1t1	T	A	4: 13,865,257	W350R	probably damaging	Het
Ryr2	T	G	13: 11,745,601	Y1532S	probably damaging	Het
Serpina1a	C	A	12: 103,853,851	V379L	possibly damaging	Het
Sox8	C	T	17: 25,567,914	V272I	probably damaging	Het
Spert	T	A	14: 75,592,658	T32S	probably benign	Het
Stard9	C	T	2: 120,702,630	H3123Y	probably benign	Het
Taar9	C	T	10: 24,109,012	E175K	possibly damaging	Het
Tinag	T	A	9: 77,001,615	Y348F	probably damaging	Het
Tktl2	T	C	8: 66,513,035	I415T	probably damaging	Het
Tm7sf2	G	T	19: 6,068,312	R718S	probably damaging	Het
Tmem229a	G	T	6: 24,954,658	Q366K	probably benign	Het
Txndc2	T	C	17: 65,638,291	D297G	probably benign	Het
Ulk4	A	G	9: 121,258,820	F269L	probably benign	Het
Vps39	A	T	2: 120,321,031	Y738*	probably null	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R6957:Pfas	UTSW	11	68993883	missense	probably benign	0.14
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGAGTCTTTGCCACCATC -3'
(R):5'- AGACTCCTCTGGCTGATGTG -3'

Sequencing Primer
(F):5'- GGGAGTCTTTGCCACCATCTACTG -3'
(R):5'- CTCTGGCTGATGTGGCTGTTG -3'

Posted On

2018-11-06