Incidental Mutation 'R6915:Pfas'
ID 539296
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Name phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms 4432409B16Rik, Sofa
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68876527-68899286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68883007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 759 (R759Q)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
AlphaFold Q5SUR0
Predicted Effect probably benign
Transcript: ENSMUST00000021282
AA Change: R759Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: R759Q

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149703
SMART Domains Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 3 110 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152964
SMART Domains Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

DomainStartEndE-ValueType
Pfam:AIRS_C 2 94 1.6e-12 PFAM
GATase_5 166 468 6.88e-120 SMART
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 68,894,640 (GRCm39) nonsense probably null
IGL01287:Pfas APN 11 68,892,086 (GRCm39) missense probably benign 0.09
IGL01712:Pfas APN 11 68,881,886 (GRCm39) missense probably benign 0.34
IGL02019:Pfas APN 11 68,884,289 (GRCm39) unclassified probably benign
IGL02053:Pfas APN 11 68,883,779 (GRCm39) missense probably damaging 1.00
IGL02718:Pfas APN 11 68,890,971 (GRCm39) splice site probably benign
IGL02801:Pfas APN 11 68,879,103 (GRCm39) unclassified probably benign
Surf UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68,880,862 (GRCm39) missense
R0037:Pfas UTSW 11 68,890,862 (GRCm39) missense probably damaging 1.00
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0046:Pfas UTSW 11 68,881,293 (GRCm39) missense probably benign
R0408:Pfas UTSW 11 68,891,931 (GRCm39) critical splice donor site probably null
R0532:Pfas UTSW 11 68,893,455 (GRCm39) splice site probably benign
R0707:Pfas UTSW 11 68,888,863 (GRCm39) missense probably benign 0.00
R0783:Pfas UTSW 11 68,891,347 (GRCm39) missense probably damaging 1.00
R0946:Pfas UTSW 11 68,881,573 (GRCm39) splice site probably null
R0946:Pfas UTSW 11 68,884,121 (GRCm39) critical splice donor site probably null
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1470:Pfas UTSW 11 68,882,185 (GRCm39) missense probably benign
R1507:Pfas UTSW 11 68,880,860 (GRCm39) missense probably benign 0.06
R1699:Pfas UTSW 11 68,888,872 (GRCm39) critical splice acceptor site probably null
R1870:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1871:Pfas UTSW 11 68,882,795 (GRCm39) missense probably damaging 1.00
R1959:Pfas UTSW 11 68,885,110 (GRCm39) missense probably damaging 1.00
R2026:Pfas UTSW 11 68,884,783 (GRCm39) missense probably damaging 1.00
R2180:Pfas UTSW 11 68,883,013 (GRCm39) missense possibly damaging 0.92
R3808:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3809:Pfas UTSW 11 68,880,779 (GRCm39) intron probably benign
R3872:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R3906:Pfas UTSW 11 68,879,112 (GRCm39) unclassified probably benign
R4092:Pfas UTSW 11 68,884,775 (GRCm39) missense probably benign
R4437:Pfas UTSW 11 68,879,243 (GRCm39) missense probably damaging 1.00
R4599:Pfas UTSW 11 68,881,895 (GRCm39) missense probably benign 0.15
R4763:Pfas UTSW 11 68,881,020 (GRCm39) missense possibly damaging 0.81
R5116:Pfas UTSW 11 68,881,816 (GRCm39) intron probably benign
R5310:Pfas UTSW 11 68,878,847 (GRCm39) missense probably damaging 1.00
R5328:Pfas UTSW 11 68,879,418 (GRCm39) missense probably damaging 1.00
R5351:Pfas UTSW 11 68,882,217 (GRCm39) missense probably damaging 1.00
R5427:Pfas UTSW 11 68,891,979 (GRCm39) missense possibly damaging 0.90
R5533:Pfas UTSW 11 68,882,296 (GRCm39) missense probably benign 0.02
R5602:Pfas UTSW 11 68,881,871 (GRCm39) missense probably benign 0.05
R5637:Pfas UTSW 11 68,884,149 (GRCm39) missense probably damaging 1.00
R5645:Pfas UTSW 11 68,881,958 (GRCm39) missense probably damaging 1.00
R6149:Pfas UTSW 11 68,882,771 (GRCm39) missense probably benign 0.07
R6295:Pfas UTSW 11 68,888,825 (GRCm39) missense probably benign 0.36
R6305:Pfas UTSW 11 68,892,023 (GRCm39) missense possibly damaging 0.51
R6387:Pfas UTSW 11 68,891,291 (GRCm39) missense probably damaging 1.00
R6425:Pfas UTSW 11 68,881,897 (GRCm39) missense probably benign 0.17
R6523:Pfas UTSW 11 68,881,283 (GRCm39) missense probably benign
R6914:Pfas UTSW 11 68,883,007 (GRCm39) missense probably benign 0.01
R6945:Pfas UTSW 11 68,891,356 (GRCm39) missense probably benign
R6957:Pfas UTSW 11 68,884,709 (GRCm39) missense probably benign 0.14
R7025:Pfas UTSW 11 68,881,586 (GRCm39) missense probably benign 0.01
R7257:Pfas UTSW 11 68,883,785 (GRCm39) missense probably damaging 1.00
R7386:Pfas UTSW 11 68,894,600 (GRCm39) missense probably benign
R7424:Pfas UTSW 11 68,890,918 (GRCm39) missense probably damaging 1.00
R7459:Pfas UTSW 11 68,879,481 (GRCm39) missense
R7593:Pfas UTSW 11 68,881,921 (GRCm39) missense
R7731:Pfas UTSW 11 68,890,871 (GRCm39) missense probably damaging 1.00
R8103:Pfas UTSW 11 68,883,119 (GRCm39) missense probably damaging 0.98
R8248:Pfas UTSW 11 68,891,089 (GRCm39) missense probably damaging 1.00
R8804:Pfas UTSW 11 68,881,908 (GRCm39) missense
R8853:Pfas UTSW 11 68,883,744 (GRCm39) missense probably damaging 1.00
R9032:Pfas UTSW 11 68,879,421 (GRCm39) missense
R9050:Pfas UTSW 11 68,882,567 (GRCm39) missense probably benign 0.01
R9283:Pfas UTSW 11 68,884,708 (GRCm39) missense probably damaging 1.00
R9644:Pfas UTSW 11 68,883,542 (GRCm39) missense probably benign 0.23
Z1176:Pfas UTSW 11 68,893,313 (GRCm39) missense probably damaging 1.00
Z1176:Pfas UTSW 11 68,880,896 (GRCm39) missense
Z1177:Pfas UTSW 11 68,893,319 (GRCm39) nonsense probably null
Z1177:Pfas UTSW 11 68,881,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAGTCTTTGCCACCATC -3'
(R):5'- AGACTCCTCTGGCTGATGTG -3'

Sequencing Primer
(F):5'- GGGAGTCTTTGCCACCATCTACTG -3'
(R):5'- CTCTGGCTGATGTGGCTGTTG -3'
Posted On 2018-11-06