Incidental Mutation 'R6915:Cfap70'
ID 539303
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Name cilia and flagella associated protein 70
Synonyms 5330402L21Rik, Ttc18
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001163638.1, NM_001163639.1, NM_029698.1; MGI: 1923920

Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 20394193-20452226 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20409085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 693 (I693F)
Ref Sequence ENSEMBL: ENSMUSP00000022348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
AlphaFold D3YVL2
Predicted Effect probably benign
Transcript: ENSMUST00000022348
AA Change: I693F

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: I693F

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022349
AA Change: I681F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: I681F

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056073
AA Change: I737F

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: I737F

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20412462 missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20394680 missense probably benign 0.30
IGL00773:Cfap70 APN 14 20447534 missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20447625 splice site probably benign
IGL01520:Cfap70 APN 14 20420687 missense probably benign 0.23
IGL01665:Cfap70 APN 14 20403118 missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20425399 missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20394972 missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20409064 splice site probably null
IGL03142:Cfap70 APN 14 20397215 missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20431982 missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20448578 missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20448608 missense probably benign 0.00
P0008:Cfap70 UTSW 14 20416532 missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20424471 splice site probably benign
R0200:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0207:Cfap70 UTSW 14 20412347 missense probably damaging 1.00
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0238:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0239:Cfap70 UTSW 14 20448605 missense probably benign 0.01
R0463:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0608:Cfap70 UTSW 14 20448563 missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20439715 missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20404164 missense probably benign 0.00
R0928:Cfap70 UTSW 14 20443919 missense probably damaging 1.00
R1595:Cfap70 UTSW 14 20447536 missense probably benign 0.10
R1667:Cfap70 UTSW 14 20404157 missense probably benign 0.41
R1799:Cfap70 UTSW 14 20394999 missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20408610 nonsense probably null
R1920:Cfap70 UTSW 14 20394952 missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20420811 missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20408562 missense probably benign 0.00
R3081:Cfap70 UTSW 14 20420762 missense probably damaging 1.00
R3813:Cfap70 UTSW 14 20421122 missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20439719 missense probably benign 0.11
R4093:Cfap70 UTSW 14 20409113 missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20420725 missense probably benign 0.00
R4604:Cfap70 UTSW 14 20443661 missense probably benign 0.01
R4839:Cfap70 UTSW 14 20425529 missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20448575 missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20401039 splice site probably null
R7317:Cfap70 UTSW 14 20400434 missense possibly damaging 0.78
R7400:Cfap70 UTSW 14 20408267 missense probably benign
R7962:Cfap70 UTSW 14 20436786 missense probably benign 0.00
R7974:Cfap70 UTSW 14 20420750 missense probably damaging 0.99
R7996:Cfap70 UTSW 14 20409126 missense probably benign 0.02
R8897:Cfap70 UTSW 14 20443601 critical splice donor site probably null
R9116:Cfap70 UTSW 14 20447522 missense probably benign 0.01
R9174:Cfap70 UTSW 14 20443638 missense probably damaging 1.00
R9649:Cfap70 UTSW 14 20400478 missense probably damaging 0.99
R9667:Cfap70 UTSW 14 20440622 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACTTCCCACCATCATAG -3'
(R):5'- GCAACTCGACCTTGTCTTTG -3'

Sequencing Primer
(F):5'- TGGTGGCTCACAACCATC -3'
(R):5'- TGCTCCATTGAAGCACCATGG -3'
Posted On 2018-11-06