Incidental Mutation 'R6915:BC024139'
ID 539305
Institutional Source Beutler Lab
Gene Symbol BC024139
Ensembl Gene ENSMUSG00000044361
Gene Name cDNA sequence BC024139
Synonyms 6230424I18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76119517-76126596 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76120021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 739 (N739K)
Ref Sequence ENSEMBL: ENSMUSP00000053305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054022] [ENSMUST00000089654] [ENSMUST00000146157] [ENSMUST00000226781]
AlphaFold Q8BVJ3
Predicted Effect probably benign
Transcript: ENSMUST00000054022
AA Change: N739K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053305
Gene: ENSMUSG00000044361
AA Change: N739K

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 672 701 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089654
SMART Domains Protein: ENSMUSP00000087082
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Pfam:GAS2 671 703 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146157
SMART Domains Protein: ENSMUSP00000117783
Gene: ENSMUSG00000044361

DomainStartEndE-ValueType
low complexity region 61 79 N/A INTRINSIC
SPEC 91 177 8.82e-1 SMART
SPEC 184 283 2.74e-2 SMART
coiled coil region 314 337 N/A INTRINSIC
low complexity region 469 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226781
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in BC024139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:BC024139 APN 15 76125100 missense probably benign 0.06
IGL01684:BC024139 APN 15 76124685 missense probably damaging 1.00
IGL01780:BC024139 APN 15 76121143 missense probably benign 0.01
IGL03084:BC024139 APN 15 76119807 missense probably benign 0.00
IGL03242:BC024139 APN 15 76120320 missense probably benign 0.32
IGL03386:BC024139 APN 15 76121745 missense probably benign 0.18
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0018:BC024139 UTSW 15 76120887 nonsense probably null
R0153:BC024139 UTSW 15 76121747 missense probably damaging 0.96
R0789:BC024139 UTSW 15 76121083 missense possibly damaging 0.51
R1158:BC024139 UTSW 15 76120342 unclassified probably benign
R1515:BC024139 UTSW 15 76124326 missense possibly damaging 0.83
R1840:BC024139 UTSW 15 76120642 missense probably benign
R1845:BC024139 UTSW 15 76125261 nonsense probably null
R2159:BC024139 UTSW 15 76121488 missense probably damaging 0.96
R2264:BC024139 UTSW 15 76125917 missense probably damaging 1.00
R2680:BC024139 UTSW 15 76121739 missense probably damaging 0.98
R2697:BC024139 UTSW 15 76120193 unclassified probably benign
R4113:BC024139 UTSW 15 76121627 missense probably benign 0.35
R4630:BC024139 UTSW 15 76125094 missense probably benign 0.23
R4825:BC024139 UTSW 15 76120317 missense possibly damaging 0.84
R4865:BC024139 UTSW 15 76126066 missense possibly damaging 0.56
R5208:BC024139 UTSW 15 76124665 missense probably benign 0.03
R5369:BC024139 UTSW 15 76120222 missense probably benign 0.02
R5371:BC024139 UTSW 15 76120686 makesense probably null
R5897:BC024139 UTSW 15 76126139 missense possibly damaging 0.84
R6110:BC024139 UTSW 15 76119796 missense probably benign
R6374:BC024139 UTSW 15 76120457 critical splice donor site probably null
R6823:BC024139 UTSW 15 76119746 makesense probably null
R7075:BC024139 UTSW 15 76124399 missense probably benign 0.06
R7669:BC024139 UTSW 15 76120568 missense possibly damaging 0.93
R8340:BC024139 UTSW 15 76121470 missense probably benign 0.03
R8355:BC024139 UTSW 15 76119807 missense probably benign 0.00
R8455:BC024139 UTSW 15 76119807 missense probably benign 0.00
R8481:BC024139 UTSW 15 76120682 missense probably damaging 0.99
R8507:BC024139 UTSW 15 76120133 missense possibly damaging 0.53
R8804:BC024139 UTSW 15 76124084 missense possibly damaging 0.92
R8876:BC024139 UTSW 15 76126120 missense possibly damaging 0.86
R9213:BC024139 UTSW 15 76125222 missense probably benign 0.00
R9542:BC024139 UTSW 15 76125515 missense probably damaging 0.99
R9555:BC024139 UTSW 15 76121159 missense possibly damaging 0.68
X0066:BC024139 UTSW 15 76124002 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGCTTCATCTCACCATTCAG -3'
(R):5'- ATGACCCAGTCAGAGGTGAG -3'

Sequencing Primer
(F):5'- AGCTCCCTGACATTTCCCAC -3'
(R):5'- ACATGTAAGTCATCAGGGTGTG -3'
Posted On 2018-11-06