Incidental Mutation 'R6915:Dzip3'
ID 539308
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene Name DAZ interacting protein 3, zinc finger
Synonyms 2A-HUB, 2310047C04Rik, 6430549P11Rik
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 48744591-48814505 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48762488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 794 (I794V)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000114516
AA Change: I588V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: I588V

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121869
AA Change: I794V

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: I794V

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48,748,778 (GRCm39) missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48,755,860 (GRCm39) critical splice donor site probably null
IGL01109:Dzip3 APN 16 48,750,037 (GRCm39) missense probably benign 0.27
IGL01121:Dzip3 APN 16 48,765,244 (GRCm39) missense probably benign 0.10
IGL01328:Dzip3 APN 16 48,792,621 (GRCm39) missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48,748,726 (GRCm39) missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48,768,790 (GRCm39) missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48,792,617 (GRCm39) missense probably benign 0.01
IGL02115:Dzip3 APN 16 48,768,848 (GRCm39) missense probably benign 0.00
IGL02125:Dzip3 APN 16 48,747,959 (GRCm39) missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48,747,945 (GRCm39) missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48,801,351 (GRCm39) missense probably benign 0.01
IGL02253:Dzip3 APN 16 48,765,287 (GRCm39) missense probably benign 0.34
IGL02412:Dzip3 APN 16 48,778,820 (GRCm39) missense probably benign 0.00
IGL02452:Dzip3 APN 16 48,758,900 (GRCm39) splice site probably benign
IGL02481:Dzip3 APN 16 48,795,914 (GRCm39) splice site probably benign
IGL02499:Dzip3 APN 16 48,754,213 (GRCm39) missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48,757,343 (GRCm39) missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48,748,759 (GRCm39) missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48,772,016 (GRCm39) missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48,762,446 (GRCm39) missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48,749,986 (GRCm39) missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48,772,059 (GRCm39) missense probably benign 0.32
corvette UTSW 16 48,747,903 (GRCm39) critical splice donor site probably null
dazwick UTSW 16 48,778,828 (GRCm39) missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48,771,920 (GRCm39) missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48,765,241 (GRCm39) missense probably benign
R0313:Dzip3 UTSW 16 48,757,424 (GRCm39) missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48,768,076 (GRCm39) missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48,780,006 (GRCm39) splice site probably benign
R0744:Dzip3 UTSW 16 48,780,038 (GRCm39) missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48,774,171 (GRCm39) splice site probably benign
R0927:Dzip3 UTSW 16 48,795,840 (GRCm39) missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48,771,921 (GRCm39) missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48,781,571 (GRCm39) missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48,772,180 (GRCm39) missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48,772,044 (GRCm39) missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48,765,985 (GRCm39) missense probably benign 0.19
R1526:Dzip3 UTSW 16 48,757,369 (GRCm39) missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48,771,903 (GRCm39) splice site probably null
R1585:Dzip3 UTSW 16 48,798,241 (GRCm39) splice site probably benign
R1682:Dzip3 UTSW 16 48,778,780 (GRCm39) critical splice donor site probably null
R1957:Dzip3 UTSW 16 48,747,956 (GRCm39) missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48,774,150 (GRCm39) missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48,792,581 (GRCm39) splice site probably null
R3040:Dzip3 UTSW 16 48,748,687 (GRCm39) missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48,747,921 (GRCm39) missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48,757,426 (GRCm39) missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48,757,426 (GRCm39) missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48,795,906 (GRCm39) missense probably benign 0.08
R3851:Dzip3 UTSW 16 48,770,376 (GRCm39) missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48,778,852 (GRCm39) nonsense probably null
R4371:Dzip3 UTSW 16 48,763,818 (GRCm39) critical splice donor site probably null
R4612:Dzip3 UTSW 16 48,772,403 (GRCm39) nonsense probably null
R4671:Dzip3 UTSW 16 48,799,953 (GRCm39) nonsense probably null
R4695:Dzip3 UTSW 16 48,771,924 (GRCm39) missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48,746,332 (GRCm39) unclassified probably benign
R4769:Dzip3 UTSW 16 48,758,837 (GRCm39) missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48,774,117 (GRCm39) nonsense probably null
R5321:Dzip3 UTSW 16 48,778,038 (GRCm39) missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48,747,724 (GRCm39) intron probably benign
R6020:Dzip3 UTSW 16 48,772,205 (GRCm39) missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48,778,828 (GRCm39) missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48,772,170 (GRCm39) missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48,751,636 (GRCm39) missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48,802,446 (GRCm39) missense probably benign 0.00
R7047:Dzip3 UTSW 16 48,802,489 (GRCm39) missense probably benign 0.04
R7059:Dzip3 UTSW 16 48,801,305 (GRCm39) missense probably benign 0.34
R7095:Dzip3 UTSW 16 48,748,153 (GRCm39) missense probably benign
R7227:Dzip3 UTSW 16 48,771,932 (GRCm39) missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48,747,903 (GRCm39) critical splice donor site probably null
R7436:Dzip3 UTSW 16 48,772,352 (GRCm39) missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48,765,242 (GRCm39) missense probably benign
R7526:Dzip3 UTSW 16 48,795,837 (GRCm39) missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48,772,268 (GRCm39) missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48,754,156 (GRCm39) critical splice donor site probably null
R8188:Dzip3 UTSW 16 48,772,499 (GRCm39) missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48,798,307 (GRCm39) missense probably damaging 1.00
R8750:Dzip3 UTSW 16 48,801,338 (GRCm39) missense probably damaging 0.99
R8758:Dzip3 UTSW 16 48,798,300 (GRCm39) missense probably damaging 1.00
R8784:Dzip3 UTSW 16 48,751,628 (GRCm39) missense probably damaging 0.99
R9086:Dzip3 UTSW 16 48,781,493 (GRCm39) missense possibly damaging 0.81
R9157:Dzip3 UTSW 16 48,748,124 (GRCm39) missense probably benign
R9170:Dzip3 UTSW 16 48,772,401 (GRCm39) missense possibly damaging 0.74
R9762:Dzip3 UTSW 16 48,748,707 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAAAGGCCCCTGTAGCTG -3'
(R):5'- GGACTGAATGCACATAATGGACAC -3'

Sequencing Primer
(F):5'- GCCCCTGTAGCTGAGAAAG -3'
(R):5'- ACACTCGTTTGTAGTTTTAAGTGC -3'
Posted On 2018-11-06