Incidental Mutation 'R6915:Prkce'
ID 539311
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Name protein kinase C, epsilon
Synonyms PKCepsilon, PCK epsilon, Pkce, PKC[e], 5830406C15Rik
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 86475213-86965347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 86800835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 417 (G417A)
Ref Sequence ENSEMBL: ENSMUSP00000094874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095186] [ENSMUST00000097274] [ENSMUST00000097275]
AlphaFold P16054
Predicted Effect probably benign
Transcript: ENSMUST00000095186
Predicted Effect probably damaging
Transcript: ENSMUST00000097274
AA Change: G417A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: G417A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097275
AA Change: G417A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: G417A

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lipo3 T C 19: 33,562,293 (GRCm39) N26D probably damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86,932,890 (GRCm39) missense probably damaging 0.99
IGL01401:Prkce APN 17 86,476,268 (GRCm39) missense probably damaging 1.00
IGL01508:Prkce APN 17 86,937,513 (GRCm39) missense probably damaging 1.00
IGL02500:Prkce APN 17 86,476,342 (GRCm39) missense probably benign 0.16
IGL02957:Prkce APN 17 86,803,454 (GRCm39) missense possibly damaging 0.74
IGL03114:Prkce APN 17 86,961,983 (GRCm39) missense probably damaging 0.97
Pinnacles UTSW 17 86,784,279 (GRCm39) missense probably damaging 1.00
R0063:Prkce UTSW 17 86,789,539 (GRCm39) splice site probably benign
R0063:Prkce UTSW 17 86,789,539 (GRCm39) splice site probably benign
R0403:Prkce UTSW 17 86,476,081 (GRCm39) missense probably damaging 0.98
R0900:Prkce UTSW 17 86,932,886 (GRCm39) missense probably damaging 1.00
R0919:Prkce UTSW 17 86,937,588 (GRCm39) missense probably benign 0.06
R1413:Prkce UTSW 17 86,803,446 (GRCm39) missense possibly damaging 0.81
R1430:Prkce UTSW 17 86,866,565 (GRCm39) splice site probably benign
R1843:Prkce UTSW 17 86,782,974 (GRCm39) nonsense probably null
R2129:Prkce UTSW 17 86,803,463 (GRCm39) missense possibly damaging 0.89
R2341:Prkce UTSW 17 86,781,870 (GRCm39) missense probably damaging 1.00
R2511:Prkce UTSW 17 86,932,754 (GRCm39) missense probably damaging 1.00
R2679:Prkce UTSW 17 86,483,654 (GRCm39) intron probably benign
R3724:Prkce UTSW 17 86,476,051 (GRCm39) nonsense probably null
R3853:Prkce UTSW 17 86,476,277 (GRCm39) missense probably damaging 1.00
R4364:Prkce UTSW 17 86,784,279 (GRCm39) missense probably damaging 1.00
R4467:Prkce UTSW 17 86,927,339 (GRCm39) missense possibly damaging 0.68
R4523:Prkce UTSW 17 86,798,178 (GRCm39) critical splice acceptor site probably null
R4838:Prkce UTSW 17 86,937,511 (GRCm39) missense probably benign 0.07
R5140:Prkce UTSW 17 86,789,570 (GRCm39) missense probably benign 0.12
R5579:Prkce UTSW 17 86,927,376 (GRCm39) missense probably damaging 1.00
R6026:Prkce UTSW 17 86,800,658 (GRCm39) missense probably benign 0.02
R6048:Prkce UTSW 17 86,800,775 (GRCm39) missense probably benign
R6212:Prkce UTSW 17 86,866,729 (GRCm39) missense probably damaging 1.00
R6484:Prkce UTSW 17 86,798,237 (GRCm39) missense probably benign
R6788:Prkce UTSW 17 86,937,489 (GRCm39) missense probably damaging 1.00
R7349:Prkce UTSW 17 86,800,783 (GRCm39) missense probably benign
R7447:Prkce UTSW 17 86,866,687 (GRCm39) missense probably damaging 1.00
R7566:Prkce UTSW 17 86,800,757 (GRCm39) missense probably benign 0.00
R7577:Prkce UTSW 17 86,800,721 (GRCm39) nonsense probably null
R7638:Prkce UTSW 17 86,476,028 (GRCm39) missense probably benign 0.26
R8237:Prkce UTSW 17 86,866,646 (GRCm39) missense probably damaging 1.00
R8711:Prkce UTSW 17 86,795,625 (GRCm39) missense probably damaging 1.00
R8869:Prkce UTSW 17 86,476,370 (GRCm39) critical splice donor site probably null
R9342:Prkce UTSW 17 86,781,877 (GRCm39) missense probably damaging 1.00
RF010:Prkce UTSW 17 86,795,627 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAACATTCGGAAGGCCTTG -3'
(R):5'- TCCTACTGAGAAAGCGGGATTTC -3'

Sequencing Primer
(F):5'- AACATTCGGAAGGCCTTGTCATTTG -3'
(R):5'- AAGCGGGATTTCACATGGCTC -3'
Posted On 2018-11-06