Incidental Mutation 'R6915:Ptar1'
ID 539318
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Name protein prenyltransferase alpha subunit repeat containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock # R6915 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 23687400-23721129 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23703137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 106 (N106D)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099560]
AlphaFold A0A494B9V8
Predicted Effect probably damaging
Transcript: ENSMUST00000099560
AA Change: N106D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: N106D

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Meta Mutation Damage Score 0.3604 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23705801 missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23705712 missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0225:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0395:Ptar1 UTSW 19 23720199 missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23720340 missense probably benign 0.32
R1414:Ptar1 UTSW 19 23720291 missense possibly damaging 0.89
R3114:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R4016:Ptar1 UTSW 19 23687460 start codon destroyed probably null 0.99
R4431:Ptar1 UTSW 19 23694331 missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23703108 missense probably damaging 1.00
R5054:Ptar1 UTSW 19 23694365 missense probably damaging 1.00
R5660:Ptar1 UTSW 19 23694412 missense probably benign 0.32
R5928:Ptar1 UTSW 19 23717913 missense probably benign 0.00
R6333:Ptar1 UTSW 19 23694322 missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23717844 missense probably benign 0.01
R6834:Ptar1 UTSW 19 23717924 missense probably benign
R7381:Ptar1 UTSW 19 23708970 splice site probably null
R7424:Ptar1 UTSW 19 23718101 missense probably damaging 1.00
R7563:Ptar1 UTSW 19 23720316 missense probably benign 0.00
R7884:Ptar1 UTSW 19 23708794 missense probably benign 0.03
R9072:Ptar1 UTSW 19 23718050 missense probably benign
R9331:Ptar1 UTSW 19 23694343 missense probably benign 0.32
R9566:Ptar1 UTSW 19 23708842 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGAGGCTAGCAGTCATG -3'
(R):5'- TGCATTAGAACTGTCGTGGAG -3'

Sequencing Primer
(F):5'- CATGCCCGTGATGTCTTACAAAGG -3'
(R):5'- CATTAGAACTGTCGTGGAGATATTAC -3'
Posted On 2018-11-06