Incidental Mutation 'R6915:Lipo3'
ID 539319
Institutional Source Beutler Lab
Gene Symbol Lipo3
Ensembl Gene ENSMUSG00000024766
Gene Name lipase, member O3
Synonyms Lipo1
MMRRC Submission 045036-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R6915 (G1)
Quality Score 192.009
Status Validated
Chromosome 19
Chromosomal Location 33532560-33568069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33562293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 26 (N26D)
Ref Sequence ENSEMBL: ENSMUSP00000108127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000112508]
AlphaFold Q3UT41
Predicted Effect probably damaging
Transcript: ENSMUST00000025694
AA Change: N26D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766
AA Change: N26D

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112508
AA Change: N26D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108127
Gene: ENSMUSG00000024766
AA Change: N26D

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 8.8e-24 PFAM
Pfam:Abhydrolase_5 76 370 5.2e-12 PFAM
Pfam:Abhydrolase_6 77 384 8.5e-10 PFAM
Pfam:Abhydrolase_1 109 384 2e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,422,390 (GRCm39) L334I probably damaging Het
Akap9 T A 5: 4,010,551 (GRCm39) M436K probably benign Het
Ankmy1 A C 1: 92,816,173 (GRCm39) F314V probably null Het
Arid5b G A 10: 68,022,042 (GRCm39) Q183* probably null Het
Atp8b4 A T 2: 126,200,834 (GRCm39) L778* probably null Het
BC024139 G T 15: 76,004,221 (GRCm39) N739K probably benign Het
Carns1 T G 19: 4,219,912 (GRCm39) H441P probably benign Het
Cby2 T A 14: 75,830,098 (GRCm39) T32S probably benign Het
Ccdc121rt3 A T 5: 112,502,523 (GRCm39) W394R probably damaging Het
Cfap70 T A 14: 20,459,153 (GRCm39) I693F probably benign Het
Cldn3 A G 5: 135,015,426 (GRCm39) Q43R probably damaging Het
Col7a1 C T 9: 108,796,686 (GRCm39) P1608L probably benign Het
Cr2 T A 1: 194,853,454 (GRCm39) Y28F probably benign Het
Cyp2c38 T A 19: 39,424,512 (GRCm39) I269F probably damaging Het
Dapk1 A T 13: 60,844,256 (GRCm39) I92F probably damaging Het
Dennd4a T A 9: 64,759,771 (GRCm39) L292* probably null Het
Dhx38 T C 8: 110,286,231 (GRCm39) E353G probably benign Het
Dnm3 T C 1: 162,145,966 (GRCm39) probably null Het
Dzip3 T C 16: 48,762,488 (GRCm39) I794V possibly damaging Het
Eif2b5 T A 16: 20,321,500 (GRCm39) V351D possibly damaging Het
Epg5 T A 18: 78,022,380 (GRCm39) V1041E probably benign Het
Exoc4 A G 6: 33,898,388 (GRCm39) K869R possibly damaging Het
Fat3 C A 9: 16,289,044 (GRCm39) V160F probably benign Het
Gak A T 5: 108,750,816 (GRCm39) Y365N probably benign Het
Ghrhr T A 6: 55,360,104 (GRCm39) probably null Het
Gm21738 A G 14: 19,415,933 (GRCm38) M202T probably benign Het
Havcr2 C T 11: 46,366,738 (GRCm39) S177L probably benign Het
Hkdc1 G C 10: 62,237,711 (GRCm39) R353G possibly damaging Het
Ifi208 G A 1: 173,510,444 (GRCm39) G200S probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lair1 A T 7: 4,058,952 (GRCm39) V12E possibly damaging Het
Lyst T A 13: 13,900,629 (GRCm39) D3168E probably benign Het
Map6 G A 7: 98,917,454 (GRCm39) A76T probably damaging Het
Mcoln3 A T 3: 145,843,011 (GRCm39) probably null Het
Muc4 T C 16: 32,587,312 (GRCm39) F2718L probably benign Het
Nek11 C G 9: 105,270,256 (GRCm39) probably benign Het
Or10n7-ps1 T C 9: 39,597,832 (GRCm39) E136G unknown Het
Or2z8 C A 8: 72,811,574 (GRCm39) L17I probably benign Het
Or4d6 A G 19: 12,086,490 (GRCm39) V140A probably benign Het
Pcdh15 A T 10: 74,479,641 (GRCm39) E846V probably benign Het
Pcdhga8 C T 18: 37,858,998 (GRCm39) T18M probably benign Het
Per3 T C 4: 151,128,106 (GRCm39) M61V possibly damaging Het
Pfas C T 11: 68,883,007 (GRCm39) R759Q probably benign Het
Pitpnm1 A G 19: 4,156,947 (GRCm39) Y490C possibly damaging Het
Plcb4 A T 2: 135,789,035 (GRCm39) I272F possibly damaging Het
Ppp1r3b A G 8: 35,851,821 (GRCm39) Y220C probably damaging Het
Prkce G C 17: 86,800,835 (GRCm39) G417A probably damaging Het
Ptar1 A G 19: 23,680,501 (GRCm39) N106D probably damaging Het
Rbm15 C A 3: 107,239,627 (GRCm39) R257L probably benign Het
Rptor T G 11: 119,647,171 (GRCm39) M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 (GRCm39) W350R probably damaging Het
Ryr2 T G 13: 11,760,487 (GRCm39) Y1532S probably damaging Het
Serpina1a C A 12: 103,820,110 (GRCm39) V379L possibly damaging Het
Sox8 C T 17: 25,786,888 (GRCm39) V272I probably damaging Het
Stard9 C T 2: 120,533,111 (GRCm39) H3123Y probably benign Het
Taar9 C T 10: 23,984,910 (GRCm39) E175K possibly damaging Het
Tinag T A 9: 76,908,897 (GRCm39) Y348F probably damaging Het
Tktl2 T C 8: 66,965,687 (GRCm39) I415T probably damaging Het
Tm7sf2 G T 19: 6,118,342 (GRCm39) R718S probably damaging Het
Tmem229a G T 6: 24,954,657 (GRCm39) Q366K probably benign Het
Txndc2 T C 17: 65,945,286 (GRCm39) D297G probably benign Het
Ulk4 A G 9: 121,087,886 (GRCm39) F269L probably benign Het
Vps39 A T 2: 120,151,512 (GRCm39) Y738* probably null Het
Other mutations in Lipo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo3 APN 19 33,763,083 (GRCm39) missense probably damaging 1.00
IGL01697:Lipo3 APN 19 33,536,965 (GRCm39) missense probably damaging 1.00
IGL01916:Lipo3 APN 19 33,762,182 (GRCm39) missense probably damaging 1.00
IGL02027:Lipo3 APN 19 33,557,919 (GRCm39) nonsense probably null
IGL02047:Lipo3 APN 19 33,534,562 (GRCm39) missense probably benign 0.00
IGL02586:Lipo3 APN 19 33,559,539 (GRCm39) missense possibly damaging 0.95
IGL03005:Lipo3 APN 19 33,763,136 (GRCm39) missense possibly damaging 0.65
IGL03111:Lipo3 APN 19 33,559,637 (GRCm39) missense probably damaging 0.96
IGL03404:Lipo3 APN 19 33,560,440 (GRCm39) splice site probably benign
R0122:Lipo3 UTSW 19 33,600,086 (GRCm39) intron probably benign
R0128:Lipo3 UTSW 19 33,534,506 (GRCm39) critical splice donor site probably null
R0540:Lipo3 UTSW 19 33,536,967 (GRCm39) missense possibly damaging 0.62
R0551:Lipo3 UTSW 19 33,557,951 (GRCm39) missense probably damaging 1.00
R0568:Lipo3 UTSW 19 33,559,442 (GRCm39) splice site probably benign
R0646:Lipo3 UTSW 19 33,762,169 (GRCm39) nonsense probably null
R0669:Lipo3 UTSW 19 33,537,025 (GRCm39) missense probably benign 0.05
R1704:Lipo3 UTSW 19 33,757,743 (GRCm39) missense possibly damaging 0.87
R1772:Lipo3 UTSW 19 33,764,821 (GRCm39) missense probably benign 0.45
R1862:Lipo3 UTSW 19 33,762,092 (GRCm39) missense probably damaging 1.00
R1863:Lipo3 UTSW 19 33,762,092 (GRCm39) missense probably damaging 1.00
R2911:Lipo3 UTSW 19 33,556,767 (GRCm39) missense probably benign 0.00
R3801:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R3802:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R3803:Lipo3 UTSW 19 33,762,257 (GRCm39) missense probably damaging 0.99
R3973:Lipo3 UTSW 19 33,535,723 (GRCm39) missense probably damaging 1.00
R4020:Lipo3 UTSW 19 33,764,804 (GRCm39) missense probably benign 0.00
R4648:Lipo3 UTSW 19 33,760,860 (GRCm39) missense probably damaging 1.00
R4660:Lipo3 UTSW 19 33,598,360 (GRCm39) intron probably benign
R4775:Lipo3 UTSW 19 33,757,795 (GRCm39) missense probably damaging 1.00
R4787:Lipo3 UTSW 19 33,757,749 (GRCm39) missense probably benign 0.00
R4820:Lipo3 UTSW 19 33,560,497 (GRCm39) missense probably damaging 1.00
R4830:Lipo3 UTSW 19 33,753,987 (GRCm39) missense probably damaging 0.99
R4951:Lipo3 UTSW 19 33,759,621 (GRCm39) missense probably benign 0.01
R5117:Lipo3 UTSW 19 33,536,952 (GRCm39) missense probably benign
R5258:Lipo3 UTSW 19 33,591,243 (GRCm39) intron probably benign
R5799:Lipo3 UTSW 19 33,755,093 (GRCm39) intron probably benign
R5853:Lipo3 UTSW 19 33,759,630 (GRCm39) missense probably benign 0.37
R6235:Lipo3 UTSW 19 33,760,963 (GRCm39) missense probably damaging 0.96
R6296:Lipo3 UTSW 19 33,757,737 (GRCm39) missense probably benign 0.10
R6383:Lipo3 UTSW 19 33,533,831 (GRCm39) missense probably benign 0.02
R6659:Lipo3 UTSW 19 33,533,828 (GRCm39) missense possibly damaging 0.55
R6913:Lipo3 UTSW 19 33,757,705 (GRCm39) missense probably benign 0.00
R7092:Lipo3 UTSW 19 33,591,092 (GRCm39) splice site probably null
R7444:Lipo3 UTSW 19 33,535,663 (GRCm39) critical splice donor site probably null
R7532:Lipo3 UTSW 19 33,560,464 (GRCm39) missense possibly damaging 0.90
R7672:Lipo3 UTSW 19 33,757,785 (GRCm39) missense probably benign 0.23
R7796:Lipo3 UTSW 19 33,759,634 (GRCm39) missense possibly damaging 0.75
R7945:Lipo3 UTSW 19 33,533,831 (GRCm39) missense probably benign 0.02
R8683:Lipo3 UTSW 19 33,759,604 (GRCm39) missense probably benign 0.04
R8936:Lipo3 UTSW 19 33,557,880 (GRCm39) missense probably damaging 1.00
R9062:Lipo3 UTSW 19 33,757,714 (GRCm39) missense probably damaging 1.00
R9086:Lipo3 UTSW 19 33,534,529 (GRCm39) missense probably benign 0.44
R9432:Lipo3 UTSW 19 33,533,864 (GRCm39) missense probably damaging 1.00
R9615:Lipo3 UTSW 19 33,754,047 (GRCm39) missense probably benign 0.02
R9620:Lipo3 UTSW 19 33,559,629 (GRCm39) nonsense probably null
Z1176:Lipo3 UTSW 19 33,562,328 (GRCm39) missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- GCTTCCAGGGAGTAGGGATATCTTC -3'
(R):5'- CACTGAAGGAATGTTACATAAGGACAC -3'

Sequencing Primer
(F):5'- TGGGGAGTGGAGAAATACTCTTAG -3'
(R):5'- GGACACAATGTAAATGCAATAAACTG -3'
Posted On 2018-11-06