Incidental Mutation 'R6916:Ddx20'
ID539335
Institutional Source Beutler Lab
Gene Symbol Ddx20
Ensembl Gene ENSMUSG00000027905
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 20
SynonymsGEMIN3, dp103
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location105678270-105687574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105680613 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 384 (N384D)
Ref Sequence ENSEMBL: ENSMUSP00000088176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090680] [ENSMUST00000200078]
Predicted Effect probably damaging
Transcript: ENSMUST00000090680
AA Change: N384D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088176
Gene: ENSMUSG00000027905
AA Change: N384D

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
DEXDc 82 280 7.47e-44 SMART
HELICc 324 405 2.8e-25 SMART
low complexity region 434 445 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200078
SMART Domains Protein: ENSMUSP00000142675
Gene: ENSMUSG00000027905

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
Pfam:DEAD 87 134 7.6e-5 PFAM
Meta Mutation Damage Score 0.9319 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele fail to implant and develop past the 2-cell stage. Heterozygous null females are viable, healthy and fertile but show increased ovary weight, a greater number of empty follicles, a prolonged estrous phase, and reduced nocturnal and stress-induced serum ACTH levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Ddx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ddx20 APN 3 105686670 missense probably damaging 1.00
IGL01832:Ddx20 APN 3 105679011 missense probably damaging 0.99
IGL02072:Ddx20 APN 3 105680627 missense probably damaging 1.00
IGL02821:Ddx20 APN 3 105679277 missense probably benign 0.00
R0520:Ddx20 UTSW 3 105687376 missense probably benign
R0600:Ddx20 UTSW 3 105679080 missense probably damaging 1.00
R1648:Ddx20 UTSW 3 105679188 missense probably benign 0.08
R1817:Ddx20 UTSW 3 105678580 nonsense probably null
R1843:Ddx20 UTSW 3 105679082 missense probably benign 0.00
R1922:Ddx20 UTSW 3 105678584 missense probably damaging 1.00
R1955:Ddx20 UTSW 3 105679562 missense possibly damaging 0.79
R1993:Ddx20 UTSW 3 105679344 nonsense probably null
R2215:Ddx20 UTSW 3 105680340 splice site probably benign
R2241:Ddx20 UTSW 3 105683205 nonsense probably null
R2315:Ddx20 UTSW 3 105678699 missense probably damaging 1.00
R4156:Ddx20 UTSW 3 105678933 missense probably benign 0.41
R4790:Ddx20 UTSW 3 105683169 missense probably benign 0.02
R4962:Ddx20 UTSW 3 105680605 missense possibly damaging 0.95
R5072:Ddx20 UTSW 3 105682875 critical splice donor site probably null
R5361:Ddx20 UTSW 3 105683509 missense probably damaging 0.96
R5622:Ddx20 UTSW 3 105679011 missense probably damaging 0.99
R5936:Ddx20 UTSW 3 105680587 missense possibly damaging 0.96
R6007:Ddx20 UTSW 3 105683420 missense possibly damaging 0.68
R6192:Ddx20 UTSW 3 105678720 missense probably benign
R6957:Ddx20 UTSW 3 105684310 missense probably benign 0.30
R6970:Ddx20 UTSW 3 105680358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTCCCAATGTACCTAAG -3'
(R):5'- TTCTAGTTCTGGGAAAAGTGCTTTC -3'

Sequencing Primer
(F):5'- TCAGTCCCAATGTACCTAAGAGTAAG -3'
(R):5'- CATTTGCTTTGAAATAGGTTTAGTCC -3'
Posted On2018-11-06