Incidental Mutation 'R6916:Cnr1'
ID539337
Institutional Source Beutler Lab
Gene Symbol Cnr1
Ensembl Gene ENSMUSG00000044288
Gene Namecannabinoid receptor 1 (brain)
SynonymsCB1R, CB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location33924593-33948831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33943897 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 95 (D95G)
Ref Sequence ENSEMBL: ENSMUSP00000081787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057188] [ENSMUST00000084736]
Predicted Effect probably benign
Transcript: ENSMUST00000057188
AA Change: D95G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055797
Gene: ENSMUSG00000044288
AA Change: D95G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 125 319 1.4e-7 PFAM
Pfam:7TM_GPCR_Srv 126 415 1.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 127 413 1.4e-14 PFAM
Pfam:7tm_1 134 398 2.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084736
AA Change: D95G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081787
Gene: ENSMUSG00000044288
AA Change: D95G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 125 319 1.9e-7 PFAM
Pfam:7TM_GPCR_Srv 126 415 1.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 127 413 1.4e-14 PFAM
Pfam:7tm_1 134 398 2.2e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors, altered long term depression and susceptibility to induced seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Cnr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cnr1 APN 4 33944116 missense probably damaging 1.00
IGL01408:Cnr1 APN 4 33944802 missense possibly damaging 0.88
IGL02551:Cnr1 APN 4 33943686 missense probably benign
Madness UTSW 4 33944330 nonsense probably null
R1730:Cnr1 UTSW 4 33943851 missense possibly damaging 0.52
R1758:Cnr1 UTSW 4 33945000 missense probably damaging 1.00
R2322:Cnr1 UTSW 4 33944514 missense probably damaging 1.00
R4688:Cnr1 UTSW 4 33944571 missense probably benign 0.38
R5289:Cnr1 UTSW 4 33943910 nonsense probably null
R5707:Cnr1 UTSW 4 33944330 nonsense probably null
R6042:Cnr1 UTSW 4 33944751 missense probably damaging 1.00
R6630:Cnr1 UTSW 4 33944659 missense probably damaging 1.00
R6724:Cnr1 UTSW 4 33944728 missense possibly damaging 0.70
R6987:Cnr1 UTSW 4 33944739 missense probably benign 0.00
R7410:Cnr1 UTSW 4 33944119 missense probably damaging 1.00
R7721:Cnr1 UTSW 4 33944416 missense probably damaging 1.00
R7723:Cnr1 UTSW 4 33944416 missense probably damaging 1.00
R7769:Cnr1 UTSW 4 33944892 missense probably benign
U24488:Cnr1 UTSW 4 33944927 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGACATGGCATCCAAATTAG -3'
(R):5'- TGACACTTCCCAGGAGATCG -3'

Sequencing Primer
(F):5'- CATGGCATCCAAATTAGGATACTTCC -3'
(R):5'- CCAGGCTGCCAATGAAGTG -3'
Posted On2018-11-06