Incidental Mutation 'R6916:Gm5862'
ID 539341
Institutional Source Beutler Lab
Gene Symbol Gm5862
Ensembl Gene ENSMUSG00000067700
Gene Name predicted gene 5862
Synonyms
MMRRC Submission 045037-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6916 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 26223419-26227889 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 26224346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 208 (H208N)
Ref Sequence ENSEMBL: ENSMUSP00000072133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072286]
AlphaFold K7N5V5
Predicted Effect probably benign
Transcript: ENSMUST00000072286
AA Change: H208N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072133
Gene: ENSMUSG00000067700
AA Change: H208N

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.6e-25 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T A 12: 71,211,318 (GRCm39) I684K possibly damaging Het
Abcg3 T A 5: 105,122,601 (GRCm39) R97S probably benign Het
Acin1 A T 14: 54,902,873 (GRCm39) F160L probably benign Het
Aoc1l2 T A 6: 48,907,987 (GRCm39) I329N probably benign Het
Asb10 T C 5: 24,742,854 (GRCm39) D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,825 (GRCm39) S117P probably benign Het
Bahcc1 T A 11: 120,163,835 (GRCm39) V711E probably damaging Het
Baz2b A T 2: 59,799,120 (GRCm39) S335T probably benign Het
Bdkrb2 C T 12: 105,558,038 (GRCm39) A93V probably damaging Het
Cacna1d A T 14: 29,817,321 (GRCm39) V1247D probably damaging Het
Cenpb A C 2: 131,021,544 (GRCm39) F85V probably benign Het
Cep112 C A 11: 108,750,202 (GRCm39) Q142K probably damaging Het
Ciita T A 16: 10,327,071 (GRCm39) probably null Het
Cnr1 A G 4: 33,943,897 (GRCm39) D95G probably benign Het
Ctnnd1 A T 2: 84,439,990 (GRCm39) D767E probably benign Het
Ddx20 T C 3: 105,587,929 (GRCm39) N384D probably damaging Het
Dnaaf3 T A 7: 4,530,532 (GRCm39) D191V probably damaging Het
Efna1 T C 3: 89,183,695 (GRCm39) N44D possibly damaging Het
Errfi1 A T 4: 150,951,930 (GRCm39) K453* probably null Het
Fam149a C A 8: 45,803,443 (GRCm39) K349N probably damaging Het
Fbxl20 T A 11: 98,004,079 (GRCm39) I70L possibly damaging Het
Flnb C T 14: 7,907,171 (GRCm38) T1248I probably damaging Het
Frem2 T C 3: 53,455,109 (GRCm39) R2156G probably damaging Het
Ftl1 T C 7: 45,108,964 (GRCm39) Y31C probably damaging Het
Hc A T 2: 34,900,044 (GRCm39) Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,755,164 (GRCm39) Het
Ints3 T C 3: 90,313,641 (GRCm39) D329G probably damaging Het
Irak3 A T 10: 120,037,270 (GRCm39) L32Q probably damaging Het
Kifbp T C 10: 62,401,843 (GRCm39) T20A probably benign Het
Klrb1f A T 6: 129,030,774 (GRCm39) D95V probably benign Het
Krt79 C T 15: 101,844,605 (GRCm39) D260N probably benign Het
Lrp11 C A 10: 7,484,478 (GRCm39) probably null Het
Lrrc10 C A 10: 116,881,454 (GRCm39) R43S possibly damaging Het
Muc5b A T 7: 141,418,454 (GRCm39) Y3800F possibly damaging Het
Myh14 T C 7: 44,278,737 (GRCm39) K1003E probably damaging Het
Nbeal2 A G 9: 110,455,176 (GRCm39) I2567T probably damaging Het
Necab2 G T 8: 120,194,355 (GRCm39) R277L probably damaging Het
Nell1 T C 7: 50,350,927 (GRCm39) Y525H probably benign Het
Olfm4 T A 14: 80,251,638 (GRCm39) M186K probably damaging Het
Or10d1c T C 9: 38,894,200 (GRCm39) I47V probably benign Het
Or1e29 T A 11: 73,667,895 (GRCm39) Q86L probably benign Het
Or2h2b-ps1 T C 17: 37,480,864 (GRCm39) K225R probably benign Het
Pcdhb11 A T 18: 37,555,434 (GRCm39) S255C possibly damaging Het
Rrbp1 A T 2: 143,816,518 (GRCm39) C704S probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Sh2d3c C T 2: 32,642,665 (GRCm39) R552* probably null Het
Sh3d19 A G 3: 85,992,218 (GRCm39) E82G probably benign Het
Son T A 16: 91,451,673 (GRCm39) L140Q probably damaging Het
Svil G A 18: 5,114,682 (GRCm39) probably benign Het
Syne1 T C 10: 5,177,912 (GRCm39) K4854R probably benign Het
Tlcd4 T C 3: 121,000,805 (GRCm39) D276G possibly damaging Het
Tmem202 C A 9: 59,432,757 (GRCm39) probably benign Het
Trak2 T C 1: 58,949,184 (GRCm39) T539A probably benign Het
Trdn T C 10: 33,033,014 (GRCm39) S80P probably damaging Het
Ugt2b37 T A 5: 87,402,459 (GRCm39) R57S probably benign Het
Usp34 G A 11: 23,408,023 (GRCm39) R2616Q probably damaging Het
Usp48 T C 4: 137,365,544 (GRCm39) Y113H probably damaging Het
Vtcn1 G T 3: 100,795,479 (GRCm39) probably null Het
Wdr19 G A 5: 65,382,677 (GRCm39) R467Q possibly damaging Het
Wdr72 A G 9: 74,062,321 (GRCm39) Y489C probably benign Het
Wipf1 C A 2: 73,267,748 (GRCm39) G217W probably damaging Het
Other mutations in Gm5862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gm5862 APN 5 26,224,514 (GRCm39) missense probably benign
IGL01863:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01868:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01873:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01881:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01902:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01905:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01909:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01917:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01924:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01927:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL01951:Gm5862 APN 5 26,227,769 (GRCm39) missense probably benign
IGL03374:Gm5862 APN 5 26,224,510 (GRCm39) missense probably damaging 0.98
R2475:Gm5862 UTSW 5 26,224,490 (GRCm39) missense probably damaging 1.00
R3828:Gm5862 UTSW 5 26,224,345 (GRCm39) missense probably benign 0.27
R4591:Gm5862 UTSW 5 26,224,486 (GRCm39) missense possibly damaging 0.95
R8291:Gm5862 UTSW 5 26,224,444 (GRCm39) missense probably benign 0.32
R8927:Gm5862 UTSW 5 26,226,678 (GRCm39) missense probably damaging 0.98
R8928:Gm5862 UTSW 5 26,226,678 (GRCm39) missense probably damaging 0.98
R9074:Gm5862 UTSW 5 26,226,624 (GRCm39) missense probably damaging 0.98
Z1176:Gm5862 UTSW 5 26,223,485 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCTCACAAGAGGTTGACTTCC -3'
(R):5'- GCAGGATCTTACCATGCAGAG -3'

Sequencing Primer
(F):5'- GAGGTTGACTTCCCAGAATACTTG -3'
(R):5'- CCATGCAGAGTGTGTTTCCAGTAAC -3'
Posted On 2018-11-06