Incidental Mutation 'R6916:Lrp11'
ID539359
Institutional Source Beutler Lab
Gene Symbol Lrp11
Ensembl Gene ENSMUSG00000019796
Gene Namelow density lipoprotein receptor-related protein 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6916 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location7589800-7625483 bp(+) (GRCm38)
Type of Mutationintron (75 bp from exon)
DNA Base Change (assembly) C to A at 7608714 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019931] [ENSMUST00000124961] [ENSMUST00000130590] [ENSMUST00000134346] [ENSMUST00000135907]
Predicted Effect probably null
Transcript: ENSMUST00000019931
SMART Domains Protein: ENSMUSP00000019931
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 283 7.62e-2 SMART
LDLa 293 330 9.45e-6 SMART
transmembrane domain 434 456 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124961
SMART Domains Protein: ENSMUSP00000114479
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
Blast:PKD 1 69 2e-42 BLAST
transmembrane domain 178 200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130590
SMART Domains Protein: ENSMUSP00000121704
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 283 7.62e-2 SMART
LDLa 293 330 9.45e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134346
SMART Domains Protein: ENSMUSP00000122853
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
MANEC 69 172 1.24e-42 SMART
PKD 198 288 1.59e-1 SMART
LDLa 298 335 9.45e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135907
SMART Domains Protein: ENSMUSP00000122359
Gene: ENSMUSG00000019796

DomainStartEndE-ValueType
MANEC 44 147 1.24e-42 SMART
transmembrane domain 196 218 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Lrp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03123:Lrp11 APN 10 7602925 missense probably damaging 1.00
R0962:Lrp11 UTSW 10 7590296 missense probably benign 0.01
R1248:Lrp11 UTSW 10 7604294 missense probably benign 0.00
R1822:Lrp11 UTSW 10 7596197 missense probably damaging 1.00
R1895:Lrp11 UTSW 10 7623776 missense probably damaging 1.00
R1902:Lrp11 UTSW 10 7623780 missense probably damaging 1.00
R1903:Lrp11 UTSW 10 7623780 missense probably damaging 1.00
R1946:Lrp11 UTSW 10 7623776 missense probably damaging 1.00
R4727:Lrp11 UTSW 10 7590584 missense probably benign 0.01
R4784:Lrp11 UTSW 10 7604201 missense possibly damaging 0.95
R6192:Lrp11 UTSW 10 7598690 critical splice acceptor site probably null
R7622:Lrp11 UTSW 10 7590172 missense unknown
R7697:Lrp11 UTSW 10 7604219 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGACAGCAATTCCTCAGGAAAG -3'
(R):5'- GAAGTGCTTGTTCCTCACTGC -3'

Sequencing Primer
(F):5'- TTCCTCAGGAAAGAACCAAGAAG -3'
(R):5'- TCCAAGGTATGCACTGACCTG -3'
Posted On2018-11-06