Incidental Mutation 'R6916:Kif1bp'
ID539361
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62566064 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000125070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect probably benign
Transcript: ENSMUST00000065887
AA Change: T279A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: T279A

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159704
AA Change: T279A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955
AA Change: T279A

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162525
AA Change: T279A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955
AA Change: T279A

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
AA Change: T20A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000162759
AA Change: T87A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955
AA Change: T87A

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
IGL02980:Kif1bp UTSW 10 62559168 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 unclassified probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R3848:Kif1bp UTSW 10 62569470 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R4489:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5193:Kif1bp UTSW 10 62559396 missense possibly damaging 0.81
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 intron probably null
R6513:Kif1bp UTSW 10 62575034 intron probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
R7376:Kif1bp UTSW 10 62559064 missense possibly damaging 0.89
R7672:Kif1bp UTSW 10 62578073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAAGTTTCAGAATTCCAGATATGT -3'
(R):5'- ACTGTTCTCCACCACAACTCTAC -3'

Sequencing Primer
(F):5'- GTTTTTAACCTGTAGTAACTTGTGTG -3'
(R):5'- CTACAAGACCCCTTTAGTGGG -3'
Posted On2018-11-06