Incidental Mutation 'R6916:Lrrc10'
ID539362
Institutional Source Beutler Lab
Gene Symbol Lrrc10
Ensembl Gene ENSMUSG00000060187
Gene Nameleucine rich repeat containing 10
SynonymsD330003I11Rik, Hrlrrp, Serdin1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location117045341-117046768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117045549 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 43 (R43S)
Ref Sequence ENSEMBL: ENSMUSP00000073502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073834]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073834
AA Change: R43S

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073502
Gene: ENSMUSG00000060187
AA Change: R43S

DomainStartEndE-ValueType
LRR 51 73 3.75e0 SMART
LRR 74 95 2.2e1 SMART
LRR 97 119 2.76e1 SMART
LRR_TYP 120 143 1.92e-2 SMART
LRR 166 189 1.62e0 SMART
low complexity region 265 274 N/A INTRINSIC
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. They show prenatal systolic dysfunction and development of dilated cardiomyopathy in postnatal life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Lrrc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01985:Lrrc10 APN 10 117046016 missense probably damaging 1.00
R0077:Lrrc10 UTSW 10 117045514 missense probably damaging 1.00
R0110:Lrrc10 UTSW 10 117045790 missense probably damaging 1.00
R0469:Lrrc10 UTSW 10 117045790 missense probably damaging 1.00
R0510:Lrrc10 UTSW 10 117045790 missense probably damaging 1.00
R1293:Lrrc10 UTSW 10 117045933 missense probably benign 0.02
R1642:Lrrc10 UTSW 10 117045883 missense probably damaging 1.00
R3835:Lrrc10 UTSW 10 117045786 missense possibly damaging 0.75
R4413:Lrrc10 UTSW 10 117045814 missense probably damaging 1.00
R5165:Lrrc10 UTSW 10 117046060 missense probably benign 0.02
R5289:Lrrc10 UTSW 10 117045487 missense probably benign 0.01
R5605:Lrrc10 UTSW 10 117045900 missense probably damaging 1.00
R6418:Lrrc10 UTSW 10 117045711 missense probably damaging 1.00
R6827:Lrrc10 UTSW 10 117045640 missense possibly damaging 0.79
R7678:Lrrc10 UTSW 10 117045757 missense probably benign 0.00
X0020:Lrrc10 UTSW 10 117045430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGCTTTTGTCACCGAATTC -3'
(R):5'- GAGCTGTTTCAAGGTACACACC -3'

Sequencing Primer
(F):5'- AAGGGTTCCCGAGCAGTG -3'
(R):5'- CACCCGGGGGAGAGCTTTG -3'
Posted On2018-11-06