Incidental Mutation 'R6917:Txndc9'
ID539381
Institutional Source Beutler Lab
Gene Symbol Txndc9
Ensembl Gene ENSMUSG00000058407
Gene Namethioredoxin domain containing 9
SynonymsATP binding protein associated with cell differentiation, Apacd
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R6917 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37985189-37997893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37995806 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 6 (S6A)
Ref Sequence ENSEMBL: ENSMUSP00000141281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252] [ENSMUST00000162031] [ENSMUST00000192237] [ENSMUST00000192960] [ENSMUST00000193832] [ENSMUST00000195032] [ENSMUST00000195247]
Predicted Effect probably benign
Transcript: ENSMUST00000027252
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162031
AA Change: S6A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125491
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192237
AA Change: S6A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141640
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Pfam:Thioredoxin 75 166 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192960
AA Change: S6A

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141281
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193832
AA Change: S6A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142188
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 6.1e-5 PFAM
Pfam:Thioredoxin 75 172 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195032
AA Change: S6A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141595
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195247
AA Change: S6A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141609
Gene: ENSMUSG00000058407
AA Change: S6A

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the thioredoxin family. The exact function of this protein is not known but it is associated with cell differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Txndc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1807:Txndc9 UTSW 1 37994015 missense probably damaging 0.99
R3918:Txndc9 UTSW 1 37994050 nonsense probably null
R4489:Txndc9 UTSW 1 37995790 nonsense probably null
R4742:Txndc9 UTSW 1 37987684 missense possibly damaging 0.90
R5020:Txndc9 UTSW 1 37995712 missense probably benign 0.44
R5341:Txndc9 UTSW 1 37987623 utr 3 prime probably benign
R6441:Txndc9 UTSW 1 37990218 missense possibly damaging 0.47
R7145:Txndc9 UTSW 1 37990296 missense probably damaging 0.98
R7686:Txndc9 UTSW 1 37987768 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTTGTTTCTGCTGCTGAGC -3'
(R):5'- CCTTTAGTCGTAGAAGCGATGGG -3'

Sequencing Primer
(F):5'- TGCTGCTGAGCCTTCCTGAG -3'
(R):5'- ACATGCTGAGTTCTAAGGCC -3'
Posted On2018-11-06