Incidental Mutation 'R6917:Lsr'
ID539392
Institutional Source Beutler Lab
Gene Symbol Lsr
Ensembl Gene ENSMUSG00000001247
Gene Namelipolysis stimulated lipoprotein receptor
SynonymsLisch7, ILDR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6917 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30957770-30973464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30958296 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000096153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001279] [ENSMUST00000058860] [ENSMUST00000098553] [ENSMUST00000108116] [ENSMUST00000108119] [ENSMUST00000147431] [ENSMUST00000162228] [ENSMUST00000170699] [ENSMUST00000172417] [ENSMUST00000205961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001279
AA Change: D481G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001279
Gene: ENSMUSG00000001247
AA Change: D481G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 206 253 9.6e-27 PFAM
low complexity region 280 296 N/A INTRINSIC
low complexity region 445 464 N/A INTRINSIC
low complexity region 468 487 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058860
SMART Domains Protein: ENSMUSP00000132256
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 241 296 1.36e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098553
AA Change: D413G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096153
Gene: ENSMUSG00000001247
AA Change: D413G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
low complexity region 212 228 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 400 419 N/A INTRINSIC
low complexity region 428 445 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108116
AA Change: D462G

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103751
Gene: ENSMUSG00000001247
AA Change: D462G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 43 186 1.23e-3 SMART
Pfam:LSR 187 235 2.3e-25 PFAM
low complexity region 261 277 N/A INTRINSIC
low complexity region 426 445 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 477 494 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108119
SMART Domains Protein: ENSMUSP00000132021
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 174 229 1.36e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000147431
AA Change: D266G
SMART Domains Protein: ENSMUSP00000123487
Gene: ENSMUSG00000001247
AA Change: D266G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 253 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162228
SMART Domains Protein: ENSMUSP00000125520
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
HLH 214 269 1.36e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166340
Predicted Effect probably benign
Transcript: ENSMUST00000170442
SMART Domains Protein: ENSMUSP00000130298
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 41 65 N/A INTRINSIC
HLH 196 243 1.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170699
Predicted Effect probably benign
Transcript: ENSMUST00000172417
SMART Domains Protein: ENSMUSP00000132833
Gene: ENSMUSG00000058239

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
HLH 110 165 1.36e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205961
AA Change: D481G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during fetal growth and development, liver hypoplasia, and variable penetrance of pallor, hemorrhaging, superficial skin detachment, and reduced size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Lsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Lsr APN 7 30971996 missense probably damaging 1.00
IGL01893:Lsr APN 7 30962232 missense possibly damaging 0.90
IGL02557:Lsr APN 7 30958494 missense possibly damaging 0.90
IGL02800:Lsr APN 7 30958413 missense probably damaging 1.00
IGL03030:Lsr APN 7 30959281 missense possibly damaging 0.50
IGL03166:Lsr APN 7 30962097 critical splice donor site probably null
R0349:Lsr UTSW 7 30959273 missense probably damaging 1.00
R0513:Lsr UTSW 7 30958338 missense probably benign 0.01
R1226:Lsr UTSW 7 30971883 missense probably damaging 1.00
R1539:Lsr UTSW 7 30972092 missense possibly damaging 0.78
R2281:Lsr UTSW 7 30958345 missense probably damaging 1.00
R4208:Lsr UTSW 7 30973094 missense probably benign 0.00
R4422:Lsr UTSW 7 30965997 missense probably benign 0.08
R4544:Lsr UTSW 7 30971976 missense probably damaging 1.00
R4727:Lsr UTSW 7 30966040 missense probably damaging 1.00
R4791:Lsr UTSW 7 30958552 missense probably damaging 0.99
R4946:Lsr UTSW 7 30958209 missense probably benign 0.17
R5157:Lsr UTSW 7 30966040 missense probably damaging 1.00
R5652:Lsr UTSW 7 30959031 missense probably damaging 1.00
R6052:Lsr UTSW 7 30958617 missense probably damaging 1.00
R6314:Lsr UTSW 7 30958599 missense probably damaging 1.00
R6566:Lsr UTSW 7 30972083 missense possibly damaging 0.92
R7842:Lsr UTSW 7 30966012 missense possibly damaging 0.82
R7925:Lsr UTSW 7 30966012 missense possibly damaging 0.82
X0050:Lsr UTSW 7 30972177 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCTCAGAGTAAGGCGGAG -3'
(R):5'- CCTTCAAGAACAGCCAAGGG -3'

Sequencing Primer
(F):5'- GGGATAGTGGCCCTCCTCTTC -3'
(R):5'- CCAAGGGGTGGTTGGGG -3'
Posted On2018-11-06