Incidental Mutation 'R6917:Gm5591'
ID539393
Institutional Source Beutler Lab
Gene Symbol Gm5591
Ensembl Gene ENSMUSG00000060565
Gene Namepredicted gene 5591
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6917 (G1)
Quality Score167.009
Status Validated
Chromosome7
Chromosomal Location38518139-38528193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38522190 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 152 (S152C)
Ref Sequence ENSEMBL: ENSMUSP00000078695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079759]
Predicted Effect probably damaging
Transcript: ENSMUST00000079759
AA Change: S152C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078695
Gene: ENSMUSG00000060565
AA Change: S152C

DomainStartEndE-ValueType
low complexity region 319 330 N/A INTRINSIC
Pfam:DUF4629 437 582 1.2e-59 PFAM
low complexity region 648 660 N/A INTRINSIC
low complexity region 693 704 N/A INTRINSIC
low complexity region 711 723 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Gm5591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gm5591 APN 7 38520414 missense probably benign 0.20
IGL02277:Gm5591 APN 7 38520432 missense probably damaging 0.98
IGL02277:Gm5591 APN 7 38519038 missense possibly damaging 0.92
IGL02503:Gm5591 APN 7 38520009 missense probably damaging 1.00
IGL02897:Gm5591 APN 7 38520042 missense probably damaging 1.00
IGL02899:Gm5591 APN 7 38519418 missense probably damaging 1.00
R1599:Gm5591 UTSW 7 38520370 missense probably benign
R2365:Gm5591 UTSW 7 38519401 missense probably damaging 1.00
R3054:Gm5591 UTSW 7 38520634 missense probably benign 0.35
R4619:Gm5591 UTSW 7 38520648 missense probably benign 0.04
R4722:Gm5591 UTSW 7 38519148 missense probably damaging 1.00
R4779:Gm5591 UTSW 7 38522256 missense probably damaging 0.96
R5079:Gm5591 UTSW 7 38522136 missense probably benign 0.01
R5237:Gm5591 UTSW 7 38522207 missense probably benign 0.31
R5267:Gm5591 UTSW 7 38518914 missense possibly damaging 0.94
R6337:Gm5591 UTSW 7 38521895 missense probably benign 0.00
R6458:Gm5591 UTSW 7 38519035 missense probably damaging 1.00
R6671:Gm5591 UTSW 7 38520099 missense possibly damaging 0.71
R6709:Gm5591 UTSW 7 38522075 missense probably benign 0.31
R6874:Gm5591 UTSW 7 38520291 missense probably damaging 0.97
R6993:Gm5591 UTSW 7 38519223 missense probably benign
R7446:Gm5591 UTSW 7 38519509 missense probably benign 0.16
R7519:Gm5591 UTSW 7 38520670 missense possibly damaging 0.70
R7596:Gm5591 UTSW 7 38520184 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTCACAGGGTAGGACAC -3'
(R):5'- TGGTGGAGCTTACTGAACAG -3'

Sequencing Primer
(F):5'- CACAGAGCTGTAGGACTGC -3'
(R):5'- CTATCCAGGTGTTCTCAAGTGG -3'
Posted On2018-11-06