Incidental Mutation 'R6917:Vsig2'
ID539399
Institutional Source Beutler Lab
Gene Symbol Vsig2
Ensembl Gene ENSMUSG00000001943
Gene NameV-set and immunoglobulin domain containing 2
SynonymsCTM, 1190004B15Rik, CTX, 2210413P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R6917 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37539255-37544205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37541449 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 105 (S105T)
Ref Sequence ENSEMBL: ENSMUSP00000150115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002008] [ENSMUST00000002011] [ENSMUST00000065668] [ENSMUST00000146860] [ENSMUST00000213699] [ENSMUST00000214142] [ENSMUST00000215271] [ENSMUST00000215957]
Predicted Effect probably benign
Transcript: ENSMUST00000002008
AA Change: S185T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000002008
Gene: ENSMUSG00000001943
AA Change: S185T

DomainStartEndE-ValueType
IGv 41 124 4.03e-8 SMART
IGc2 158 225 1.06e-7 SMART
transmembrane domain 243 265 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000002011
SMART Domains Protein: ENSMUSP00000002011
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 39 153 4.82e-6 SMART
IGc2 168 234 1.17e-4 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065668
SMART Domains Protein: ENSMUSP00000070113
Gene: ENSMUSG00000053310

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
IQ 25 47 1.92e-3 SMART
low complexity region 52 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146860
SMART Domains Protein: ENSMUSP00000122473
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
IG 9 123 4.82e-6 SMART
IGc2 138 204 1.17e-4 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213699
Predicted Effect probably benign
Transcript: ENSMUST00000214142
Predicted Effect probably benign
Transcript: ENSMUST00000215271
AA Change: S105T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Vsig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Vsig2 APN 9 37539955 missense probably damaging 0.97
IGL03023:Vsig2 APN 9 37542412 missense probably damaging 1.00
R0013:Vsig2 UTSW 9 37542576 splice site probably benign
R0013:Vsig2 UTSW 9 37542576 splice site probably benign
R0412:Vsig2 UTSW 9 37542690 missense probably damaging 1.00
R3422:Vsig2 UTSW 9 37541479 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CCACTATTTGGCAGAGGAATTG -3'
(R):5'- AAGTGTTTCCCAAGCACGG -3'

Sequencing Primer
(F):5'- AAATGTTGAAGTCAGTAGGTCTGG -3'
(R):5'- TCCCAAGCACGGCAGGAAG -3'
Posted On2018-11-06