Incidental Mutation 'R6917:Plod2'
ID539401
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6917 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92593770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 302 (V302D)
Ref Sequence ENSEMBL: ENSMUSP00000068611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070522
AA Change: V302D

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: V302D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160359
AA Change: V302D

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: V302D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGAAATGAACTTGCAGTGTG -3'
(R):5'- CACTTGGTTTTAGATGCCAGGG -3'

Sequencing Primer
(F):5'- CCGGCGATTGATGCAAGCTTAG -3'
(R):5'- TTAGATGCCAGGGAAGTCACTTC -3'
Posted On2018-11-06