Incidental Mutation 'R6917:Eno3'
ID 539404
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Name enolase 3, beta muscle
Synonyms Eno-3
MMRRC Submission 045038-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.815) question?
Stock # R6917 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70548028-70553339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70552262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 305 (T305A)
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000126241] [ENSMUST00000129434] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716]
AlphaFold P21550
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072841
AA Change: T305A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600
AA Change: T305A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108548
AA Change: T305A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600
AA Change: T305A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170716
AA Change: T305A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600
AA Change: T305A

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,437,684 (GRCm39) probably null Het
Adcy2 A T 13: 68,768,876 (GRCm39) M1084K possibly damaging Het
Ak1 A G 2: 32,521,164 (GRCm39) Y95C possibly damaging Het
Akap6 A G 12: 53,115,951 (GRCm39) E1018G probably null Het
Ccdc175 A G 12: 72,231,679 (GRCm39) S27P probably damaging Het
Ddx31 C T 2: 28,782,421 (GRCm39) T588I probably damaging Het
Dmxl1 T C 18: 49,997,215 (GRCm39) W504R probably damaging Het
Echs1 T G 7: 139,689,924 (GRCm39) M239L probably benign Het
Eno1b A G 18: 48,180,656 (GRCm39) D278G probably benign Het
Gm5591 T A 7: 38,221,614 (GRCm39) S152C probably damaging Het
Gngt1 A G 6: 3,996,680 (GRCm39) D42G probably benign Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
H2-Aa T C 17: 34,502,681 (GRCm39) T79A probably damaging Het
Ice1 A T 13: 70,743,013 (GRCm39) Y2116N probably damaging Het
Kdm6b A G 11: 69,297,419 (GRCm39) M311T probably benign Het
L1td1 T C 4: 98,622,268 (GRCm39) F277L probably benign Het
Lamp1 T C 8: 13,222,563 (GRCm39) I249T probably damaging Het
Ldb3 G A 14: 34,277,321 (GRCm39) A351V probably null Het
Lmo7 A G 14: 102,155,446 (GRCm39) E996G probably damaging Het
Lsr T C 7: 30,657,721 (GRCm39) D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,027,592 (GRCm39) probably benign Het
Myo7a T C 7: 97,744,970 (GRCm39) E290G possibly damaging Het
Nos2 C T 11: 78,842,053 (GRCm39) T735M possibly damaging Het
Or10ak12 A T 4: 118,666,326 (GRCm39) L245H probably damaging Het
Or11h6 A G 14: 50,880,680 (GRCm39) K314R possibly damaging Het
Or8g36 T A 9: 39,422,495 (GRCm39) I174L probably damaging Het
Pik3c2g T C 6: 139,841,899 (GRCm39) L768P probably benign Het
Plod2 T A 9: 92,475,823 (GRCm39) V302D possibly damaging Het
Ptgdr A T 14: 45,096,067 (GRCm39) V215E possibly damaging Het
Rad51d C T 11: 82,770,159 (GRCm39) R199Q probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Rtel1 ATT ATTTT 2: 180,980,070 (GRCm39) probably null Het
Sgip1 A G 4: 102,825,388 (GRCm39) R772G probably damaging Het
Slc19a2 C A 1: 164,088,578 (GRCm39) T141N probably damaging Het
Sp4 G T 12: 118,262,908 (GRCm39) N379K probably damaging Het
Thrap3 A G 4: 126,074,285 (GRCm39) probably benign Het
Thumpd2 T G 17: 81,351,543 (GRCm39) I293L probably benign Het
Tjp1 A G 7: 64,949,436 (GRCm39) S1649P probably damaging Het
Tssk4 A G 14: 55,889,864 (GRCm39) S326G probably benign Het
Txndc9 A C 1: 38,034,887 (GRCm39) S6A probably benign Het
Uhrf1 T C 17: 56,616,574 (GRCm39) Y131H probably damaging Het
Vnn3 A G 10: 23,741,832 (GRCm39) D379G possibly damaging Het
Vsig2 T A 9: 37,452,745 (GRCm39) S105T probably benign Het
Zfp445 A T 9: 122,691,359 (GRCm39) probably null Het
Zfp654 A T 16: 64,606,834 (GRCm39) M456K probably damaging Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70,551,714 (GRCm39) splice site probably benign
IGL02591:Eno3 APN 11 70,552,853 (GRCm39) missense probably damaging 1.00
IGL02868:Eno3 APN 11 70,552,826 (GRCm39) missense probably damaging 1.00
R7060_eno3_205 UTSW 11 70,552,245 (GRCm39) missense possibly damaging 0.95
R0242:Eno3 UTSW 11 70,548,761 (GRCm39) missense probably null 1.00
R0242:Eno3 UTSW 11 70,548,761 (GRCm39) missense probably null 1.00
R0970:Eno3 UTSW 11 70,551,628 (GRCm39) missense probably damaging 1.00
R1518:Eno3 UTSW 11 70,551,903 (GRCm39) nonsense probably null
R1587:Eno3 UTSW 11 70,552,296 (GRCm39) missense probably damaging 0.99
R1663:Eno3 UTSW 11 70,553,100 (GRCm39) critical splice donor site probably null
R1675:Eno3 UTSW 11 70,549,492 (GRCm39) critical splice donor site probably null
R1758:Eno3 UTSW 11 70,552,251 (GRCm39) missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70,552,237 (GRCm39) missense probably damaging 0.98
R4990:Eno3 UTSW 11 70,549,473 (GRCm39) missense probably damaging 0.99
R4992:Eno3 UTSW 11 70,549,473 (GRCm39) missense probably damaging 0.99
R5170:Eno3 UTSW 11 70,553,040 (GRCm39) missense probably benign 0.00
R6116:Eno3 UTSW 11 70,552,401 (GRCm39) missense possibly damaging 0.70
R7060:Eno3 UTSW 11 70,552,245 (GRCm39) missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70,549,430 (GRCm39) missense possibly damaging 0.76
R7678:Eno3 UTSW 11 70,549,993 (GRCm39) splice site probably null
R7696:Eno3 UTSW 11 70,552,809 (GRCm39) missense probably benign 0.00
R7954:Eno3 UTSW 11 70,552,006 (GRCm39) missense probably benign 0.01
R8969:Eno3 UTSW 11 70,551,691 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCTGCGGTTACCTAGCATGG -3'
(R):5'- CTGAGGCTTGAGTAGGTCAG -3'

Sequencing Primer
(F):5'- GGTTACCTAGCATGGCTCTCAG -3'
(R):5'- TTGAGTAGGTCAGGGGCCC -3'
Posted On 2018-11-06