Incidental Mutation 'R6917:Nos2'
ID 539405
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission 045038-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6917 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78842053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 735 (T735M)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: T848M

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: T848M

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: T735M

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,437,684 (GRCm39) probably null Het
Adcy2 A T 13: 68,768,876 (GRCm39) M1084K possibly damaging Het
Ak1 A G 2: 32,521,164 (GRCm39) Y95C possibly damaging Het
Akap6 A G 12: 53,115,951 (GRCm39) E1018G probably null Het
Ccdc175 A G 12: 72,231,679 (GRCm39) S27P probably damaging Het
Ddx31 C T 2: 28,782,421 (GRCm39) T588I probably damaging Het
Dmxl1 T C 18: 49,997,215 (GRCm39) W504R probably damaging Het
Echs1 T G 7: 139,689,924 (GRCm39) M239L probably benign Het
Eno1b A G 18: 48,180,656 (GRCm39) D278G probably benign Het
Eno3 A G 11: 70,552,262 (GRCm39) T305A probably benign Het
Gm5591 T A 7: 38,221,614 (GRCm39) S152C probably damaging Het
Gngt1 A G 6: 3,996,680 (GRCm39) D42G probably benign Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
H2-Aa T C 17: 34,502,681 (GRCm39) T79A probably damaging Het
Ice1 A T 13: 70,743,013 (GRCm39) Y2116N probably damaging Het
Kdm6b A G 11: 69,297,419 (GRCm39) M311T probably benign Het
L1td1 T C 4: 98,622,268 (GRCm39) F277L probably benign Het
Lamp1 T C 8: 13,222,563 (GRCm39) I249T probably damaging Het
Ldb3 G A 14: 34,277,321 (GRCm39) A351V probably null Het
Lmo7 A G 14: 102,155,446 (GRCm39) E996G probably damaging Het
Lsr T C 7: 30,657,721 (GRCm39) D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,027,592 (GRCm39) probably benign Het
Myo7a T C 7: 97,744,970 (GRCm39) E290G possibly damaging Het
Or10ak12 A T 4: 118,666,326 (GRCm39) L245H probably damaging Het
Or11h6 A G 14: 50,880,680 (GRCm39) K314R possibly damaging Het
Or8g36 T A 9: 39,422,495 (GRCm39) I174L probably damaging Het
Pik3c2g T C 6: 139,841,899 (GRCm39) L768P probably benign Het
Plod2 T A 9: 92,475,823 (GRCm39) V302D possibly damaging Het
Ptgdr A T 14: 45,096,067 (GRCm39) V215E possibly damaging Het
Rad51d C T 11: 82,770,159 (GRCm39) R199Q probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Rtel1 ATT ATTTT 2: 180,980,070 (GRCm39) probably null Het
Sgip1 A G 4: 102,825,388 (GRCm39) R772G probably damaging Het
Slc19a2 C A 1: 164,088,578 (GRCm39) T141N probably damaging Het
Sp4 G T 12: 118,262,908 (GRCm39) N379K probably damaging Het
Thrap3 A G 4: 126,074,285 (GRCm39) probably benign Het
Thumpd2 T G 17: 81,351,543 (GRCm39) I293L probably benign Het
Tjp1 A G 7: 64,949,436 (GRCm39) S1649P probably damaging Het
Tssk4 A G 14: 55,889,864 (GRCm39) S326G probably benign Het
Txndc9 A C 1: 38,034,887 (GRCm39) S6A probably benign Het
Uhrf1 T C 17: 56,616,574 (GRCm39) Y131H probably damaging Het
Vnn3 A G 10: 23,741,832 (GRCm39) D379G possibly damaging Het
Vsig2 T A 9: 37,452,745 (GRCm39) S105T probably benign Het
Zfp445 A T 9: 122,691,359 (GRCm39) probably null Het
Zfp654 A T 16: 64,606,834 (GRCm39) M456K probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCCCTTGCAGATGGAGAATAG -3'
(R):5'- AATACTGCTGTGTACTAGAGACGG -3'

Sequencing Primer
(F):5'- CATCATCTGAGAGACCCAAGTAGG -3'
(R):5'- CTGTGTACTAGAGACGGGGCAG -3'
Posted On 2018-11-06