Mutagenetix > Incidental Mutation

Incidental Mutation 'R6917:Adcy2'

539411

Institutional Source

Beutler Lab

Gene Symbol

Adcy2

Ensembl Gene

ENSMUSG00000021536

Gene Name

adenylate cyclase 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6917 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68620043-68999541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68620757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1084 (M1084K)

Ref Sequence

ENSEMBL: ENSMUSP00000022013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022013]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022013
AA Change: M1084K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: M1084K

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
low complexity region	60	74	N/A	INTRINSIC
CYCc	239	447	6.62e-66	SMART
Pfam:DUF1053	499	604	2.6e-41	PFAM
transmembrane domain	631	653	N/A	INTRINSIC
low complexity region	659	673	N/A	INTRINSIC
transmembrane domain	684	706	N/A	INTRINSIC
transmembrane domain	738	760	N/A	INTRINSIC
transmembrane domain	767	789	N/A	INTRINSIC
transmembrane domain	809	826	N/A	INTRINSIC
CYCc	851	1065	5.49e-40	SMART

Meta Mutation Damage Score

0.0931

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.6%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	A	G	16: 56,617,321		probably null	Het
Ak1	A	G	2: 32,631,152	Y95C	possibly damaging	Het
Akap6	A	G	12: 53,069,168	E1018G	probably null	Het
Ccdc175	A	G	12: 72,184,905	S27P	probably damaging	Het
Ddx31	C	T	2: 28,892,409	T588I	probably damaging	Het
Dmxl1	T	C	18: 49,864,148	W504R	probably damaging	Het
Echs1	T	G	7: 140,110,011	M239L	probably benign	Het
Eno1b	A	G	18: 48,047,589	D278G	probably benign	Het
Eno3	A	G	11: 70,661,436	T305A	probably benign	Het
Gm5591	T	A	7: 38,522,190	S152C	probably damaging	Het
Gngt1	A	G	6: 3,996,680	D42G	probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
H2-Aa	T	C	17: 34,283,707	T79A	probably damaging	Het
Ice1	A	T	13: 70,594,894	Y2116N	probably damaging	Het
Kdm6b	A	G	11: 69,406,593	M311T	probably benign	Het
L1td1	T	C	4: 98,734,031	F277L	probably benign	Het
Lamp1	T	C	8: 13,172,563	I249T	probably damaging	Het
Ldb3	G	A	14: 34,555,364	A351V	probably null	Het
Lmo7	A	G	14: 101,918,010	E996G	probably damaging	Het
Lsr	T	C	7: 30,958,296	D413G	possibly damaging	Het
Magel2	CCCTCCTCCTCCTCCTCCTCCT	CCCTCCTCCTCCTCCTCCT	7: 62,377,844		probably benign	Het
Myo7a	T	C	7: 98,095,763	E290G	possibly damaging	Het
Nos2	C	T	11: 78,951,227	T735M	possibly damaging	Het
Olfr1335	A	T	4: 118,809,129	L245H	probably damaging	Het
Olfr745	A	G	14: 50,643,223	K314R	possibly damaging	Het
Olfr957	T	A	9: 39,511,199	I174L	probably damaging	Het
Pik3c2g	T	C	6: 139,896,173	L768P	probably benign	Het
Plod2	T	A	9: 92,593,770	V302D	possibly damaging	Het
Ptgdr	A	T	14: 44,858,610	V215E	possibly damaging	Het
Rad51d	C	T	11: 82,879,333	R199Q	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rtel1	ATT	ATTTT	2: 181,338,277		probably null	Het
Sgip1	A	G	4: 102,968,191	R772G	probably damaging	Het
Slc19a2	C	A	1: 164,261,009	T141N	probably damaging	Het
Sp4	G	T	12: 118,299,173	N379K	probably damaging	Het
Thrap3	A	G	4: 126,180,492		probably benign	Het
Thumpd2	T	G	17: 81,044,114	I293L	probably benign	Het
Tjp1	A	G	7: 65,299,688	S1649P	probably damaging	Het
Tssk4	A	G	14: 55,652,407	S326G	probably benign	Het
Txndc9	A	C	1: 37,995,806	S6A	probably benign	Het
Uhrf1	T	C	17: 56,309,574	Y131H	probably damaging	Het
Vnn3	A	G	10: 23,865,934	D379G	possibly damaging	Het
Vsig2	T	A	9: 37,541,449	S105T	probably benign	Het
Zfp445	A	T	9: 122,862,294		probably null	Het
Zfp654	A	T	16: 64,786,471	M456K	probably damaging	Het

Other mutations in Adcy2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Adcy2	APN	13	68620796	missense	probably damaging	1.00
IGL01074:Adcy2	APN	13	68796654	missense	possibly damaging	0.93
IGL01394:Adcy2	APN	13	68982402	missense	probably damaging	1.00
IGL01820:Adcy2	APN	13	68738545	splice site	probably null
IGL02048:Adcy2	APN	13	68888067	missense	possibly damaging	0.46
IGL02378:Adcy2	APN	13	68730292	missense	probably damaging	1.00
IGL02419:Adcy2	APN	13	68982363	missense	probably benign	0.40
IGL02896:Adcy2	APN	13	68727872	missense	probably damaging	1.00
IGL02953:Adcy2	APN	13	68729328	missense	probably damaging	1.00
IGL03358:Adcy2	APN	13	68729277	missense	probably damaging	1.00
IGL03387:Adcy2	APN	13	68730367	missense	probably damaging	1.00
PIT4305001:Adcy2	UTSW	13	68678602	missense	probably benign	0.00
PIT4366001:Adcy2	UTSW	13	68709990	critical splice donor site	probably benign
R0044:Adcy2	UTSW	13	68727899	missense	possibly damaging	0.94
R0044:Adcy2	UTSW	13	68727899	missense	possibly damaging	0.94
R0083:Adcy2	UTSW	13	68651935	missense	probably damaging	0.99
R0108:Adcy2	UTSW	13	68651935	missense	probably damaging	0.99
R0269:Adcy2	UTSW	13	68678606	nonsense	probably null
R0369:Adcy2	UTSW	13	68671900	missense	probably benign	0.00
R0480:Adcy2	UTSW	13	68732112	missense	probably damaging	1.00
R0550:Adcy2	UTSW	13	68982361	missense	probably benign	0.23
R0551:Adcy2	UTSW	13	68796539	missense	probably damaging	1.00
R0617:Adcy2	UTSW	13	68678606	nonsense	probably null
R0634:Adcy2	UTSW	13	68727945	missense	possibly damaging	0.48
R0715:Adcy2	UTSW	13	68888042	missense	probably benign	0.08
R0723:Adcy2	UTSW	13	68999129	missense	probably damaging	1.00
R1136:Adcy2	UTSW	13	68730317	missense	probably damaging	1.00
R1271:Adcy2	UTSW	13	68642498	missense	probably damaging	1.00
R1349:Adcy2	UTSW	13	68668533	missense	probably damaging	0.98
R1372:Adcy2	UTSW	13	68668533	missense	probably damaging	0.98
R1390:Adcy2	UTSW	13	68657393	missense	possibly damaging	0.94
R1495:Adcy2	UTSW	13	68796535	missense	probably benign	0.30
R1706:Adcy2	UTSW	13	68720746	missense	probably damaging	1.00
R1839:Adcy2	UTSW	13	68689261	splice site	probably null
R2004:Adcy2	UTSW	13	68796603	missense	probably damaging	1.00
R2235:Adcy2	UTSW	13	68668492	missense	probably damaging	0.98
R2242:Adcy2	UTSW	13	68689341	missense	probably benign	0.00
R2940:Adcy2	UTSW	13	68730305	missense	probably damaging	1.00
R3624:Adcy2	UTSW	13	68642531	missense	probably damaging	0.99
R3689:Adcy2	UTSW	13	68630969	missense	probably damaging	1.00
R4685:Adcy2	UTSW	13	68727905	missense	probably benign	0.32
R4695:Adcy2	UTSW	13	68727843	missense	possibly damaging	0.67
R5213:Adcy2	UTSW	13	68620823	missense	possibly damaging	0.61
R5645:Adcy2	UTSW	13	68729202	splice site	probably null
R5687:Adcy2	UTSW	13	68620819	nonsense	probably null
R5687:Adcy2	UTSW	13	68642569	missense	probably damaging	1.00
R5833:Adcy2	UTSW	13	68738603	missense	probably benign
R5846:Adcy2	UTSW	13	68738588	missense	probably damaging	0.99
R5894:Adcy2	UTSW	13	68625852	missense	probably damaging	1.00
R6111:Adcy2	UTSW	13	68729241	missense	probably damaging	0.99
R6311:Adcy2	UTSW	13	68625792	missense	probably damaging	1.00
R6642:Adcy2	UTSW	13	68620826	missense	probably damaging	1.00
R6644:Adcy2	UTSW	13	68668552	missense	possibly damaging	0.88
R6899:Adcy2	UTSW	13	68982381	missense	probably damaging	0.99
R6950:Adcy2	UTSW	13	68888065	missense	possibly damaging	0.93
R7006:Adcy2	UTSW	13	68888020	missense	probably damaging	1.00
R7186:Adcy2	UTSW	13	68668639	missense	probably damaging	1.00
R7311:Adcy2	UTSW	13	68630954	missense	probably damaging	1.00
R7348:Adcy2	UTSW	13	68734675	missense	possibly damaging	0.79
R7440:Adcy2	UTSW	13	68796667	missense	probably damaging	0.97
R7463:Adcy2	UTSW	13	68730280	missense	probably damaging	1.00
R7827:Adcy2	UTSW	13	68689281	missense	probably damaging	1.00
R7919:Adcy2	UTSW	13	68887972	missense	probably benign	0.08
R8144:Adcy2	UTSW	13	68734635	nonsense	probably null
R8256:Adcy2	UTSW	13	68620761	missense	probably damaging	1.00
R8556:Adcy2	UTSW	13	68630975	missense	possibly damaging	0.61
R9121:Adcy2	UTSW	13	68671959	missense	probably benign	0.35
R9128:Adcy2	UTSW	13	68625808	missense	probably damaging	1.00
R9255:Adcy2	UTSW	13	68888080	missense	possibly damaging	0.93
R9464:Adcy2	UTSW	13	68734657	missense	probably damaging	1.00
R9749:Adcy2	UTSW	13	68625855	missense	probably damaging	1.00
R9799:Adcy2	UTSW	13	68620842	missense	probably benign	0.03
R9799:Adcy2	UTSW	13	68657370	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGTGGCAGGACAATCTG -3'
(R):5'- CCCTGTATGAAGTGGGCTACATTG -3'

Sequencing Primer
(F):5'- CTGGGTCACAGGAACTAGTCTG -3'
(R):5'- GCTACATTGCCTTGTAAAGTAATCCC -3'

Posted On

2018-11-06