Incidental Mutation 'R6917:Adcy2'
ID539411
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Nameadenylate cyclase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6917 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location68620043-68999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68620757 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1084 (M1084K)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022013
AA Change: M1084K

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: M1084K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0369:Adcy2 UTSW 13 68671900 missense probably benign 0.00
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0550:Adcy2 UTSW 13 68982361 missense probably benign 0.23
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R0723:Adcy2 UTSW 13 68999129 missense probably damaging 1.00
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1706:Adcy2 UTSW 13 68720746 missense probably damaging 1.00
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6311:Adcy2 UTSW 13 68625792 missense probably damaging 1.00
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTGGCAGGACAATCTG -3'
(R):5'- CCCTGTATGAAGTGGGCTACATTG -3'

Sequencing Primer
(F):5'- CTGGGTCACAGGAACTAGTCTG -3'
(R):5'- GCTACATTGCCTTGTAAAGTAATCCC -3'
Posted On2018-11-06